ID: 1042930538

View in Genome Browser
Species Human (GRCh38)
Location 8:74008928-74008950
Sequence ACCAAAGAAGGTTTAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042930533_1042930538 2 Left 1042930533 8:74008903-74008925 CCTGGAAGGGAGTGGTTGCACCA No data
Right 1042930538 8:74008928-74008950 ACCAAAGAAGGTTTAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042930538 Original CRISPR ACCAAAGAAGGTTTAGGGAA AGG Intronic