ID: 1042934760

View in Genome Browser
Species Human (GRCh38)
Location 8:74047388-74047410
Sequence ACGTCTACCCATAAGTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042934760_1042934768 18 Left 1042934760 8:74047388-74047410 CCCCACAACTTATGGGTAGACGT No data
Right 1042934768 8:74047429-74047451 AGCATTTCTTCACCAGAATCAGG No data
1042934760_1042934767 -5 Left 1042934760 8:74047388-74047410 CCCCACAACTTATGGGTAGACGT No data
Right 1042934767 8:74047406-74047428 GACGTGGAGGCAGAGGGTTCAGG No data
1042934760_1042934771 28 Left 1042934760 8:74047388-74047410 CCCCACAACTTATGGGTAGACGT No data
Right 1042934771 8:74047439-74047461 CACCAGAATCAGGGTACAGGAGG No data
1042934760_1042934770 25 Left 1042934760 8:74047388-74047410 CCCCACAACTTATGGGTAGACGT No data
Right 1042934770 8:74047436-74047458 CTTCACCAGAATCAGGGTACAGG No data
1042934760_1042934769 19 Left 1042934760 8:74047388-74047410 CCCCACAACTTATGGGTAGACGT No data
Right 1042934769 8:74047430-74047452 GCATTTCTTCACCAGAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042934760 Original CRISPR ACGTCTACCCATAAGTTGTG GGG (reversed) Intergenic
No off target data available for this crispr