ID: 1042937178

View in Genome Browser
Species Human (GRCh38)
Location 8:74071385-74071407
Sequence CAGAGTTAACTCTTTAATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042937176_1042937178 16 Left 1042937176 8:74071346-74071368 CCAAATAGTTCTTCTTCTTTCAG No data
Right 1042937178 8:74071385-74071407 CAGAGTTAACTCTTTAATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042937178 Original CRISPR CAGAGTTAACTCTTTAATGT AGG Intergenic
No off target data available for this crispr