ID: 1042942123

View in Genome Browser
Species Human (GRCh38)
Location 8:74118381-74118403
Sequence AGGTGGGGAGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042942123_1042942138 28 Left 1042942123 8:74118381-74118403 CCTTCTTCCCTCTCTCCCCACCT No data
Right 1042942138 8:74118432-74118454 CACTGCAACCTCCACCTCCTGGG 0: 18142
1: 77553
2: 162299
3: 223094
4: 165620
1042942123_1042942137 27 Left 1042942123 8:74118381-74118403 CCTTCTTCCCTCTCTCCCCACCT No data
Right 1042942137 8:74118431-74118453 TCACTGCAACCTCCACCTCCTGG 0: 32521
1: 84464
2: 158961
3: 135320
4: 82864
1042942123_1042942127 -8 Left 1042942123 8:74118381-74118403 CCTTCTTCCCTCTCTCCCCACCT No data
Right 1042942127 8:74118396-74118418 CCCCACCTCCCTCCCTCCAGTGG No data
1042942123_1042942133 3 Left 1042942123 8:74118381-74118403 CCTTCTTCCCTCTCTCCCCACCT No data
Right 1042942133 8:74118407-74118429 TCCCTCCAGTGGCGCAATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042942123 Original CRISPR AGGTGGGGAGAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr