ID: 1042944962

View in Genome Browser
Species Human (GRCh38)
Location 8:74145263-74145285
Sequence CTGTGGATAAGGTGAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042944953_1042944962 26 Left 1042944953 8:74145214-74145236 CCGGCAGGGAGAGATGGGCACAG No data
Right 1042944962 8:74145263-74145285 CTGTGGATAAGGTGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042944962 Original CRISPR CTGTGGATAAGGTGAGATGC AGG Intergenic
No off target data available for this crispr