ID: 1042947716

View in Genome Browser
Species Human (GRCh38)
Location 8:74171566-74171588
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 2, 1: 2, 2: 5, 3: 19, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042947716_1042947722 6 Left 1042947716 8:74171566-74171588 CCAGTGTTCAACAGTGACACCAT 0: 2
1: 2
2: 5
3: 19
4: 128
Right 1042947722 8:74171595-74171617 GGGATGAAGCTTGCTGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042947716 Original CRISPR ATGGTGTCACTGTTGAACAC TGG (reversed) Intergenic
902925901 1:19695510-19695532 ATGGTGTTATTTTTGCACACTGG + Intronic
906717388 1:47980231-47980253 ATGGTGCCACTCCTGAACCCAGG + Intronic
907386915 1:54131960-54131982 ATGGTGTCAGTGTTGAAGGCTGG - Intergenic
908027045 1:59963670-59963692 ATGGTGTCTCAGTTGAAAACGGG - Intergenic
909030609 1:70534615-70534637 ATGGTATAACAGTTTAACACTGG + Intergenic
911604679 1:99890284-99890306 TTGGTCTCACTGTTGAATAATGG - Intronic
912539587 1:110403826-110403848 AAGGAATCACTGATGAACACAGG + Intronic
913162608 1:116158220-116158242 ATGGTCTCACTGATGAATTCTGG - Intergenic
913491683 1:119385750-119385772 TTGGTGTCACAGTTGCCCACTGG - Intronic
916239993 1:162630045-162630067 CTGGTGTCAAGGCTGAACACTGG + Intergenic
919374182 1:196771435-196771457 CTGATGTCCCTGTTGAACAGAGG - Intergenic
919649380 1:200131134-200131156 ATGGTGTAAATATTGAACAGTGG - Intronic
920963159 1:210681691-210681713 ATGGGGTCACCGTCTAACACAGG + Exonic
921105642 1:211974854-211974876 ATGGTGGTACTGATGCACACAGG + Intronic
921793593 1:219317930-219317952 TTGGTGACACTGTTGACAACTGG - Intergenic
922052715 1:222009285-222009307 ATGGTTTCACTTTTGCTCACGGG + Intergenic
922936268 1:229425550-229425572 CTGGTGTTTCTGTTGAACATAGG - Intergenic
1063166220 10:3465268-3465290 AGCGTGTCACAGTTGAACTCTGG + Intergenic
1063873528 10:10446151-10446173 ATGGGGCCACTGTGGAAGACAGG - Intergenic
1069720012 10:70543960-70543982 ATGATGTAACTTTGGAACACAGG - Intronic
1074610094 10:115013652-115013674 ATGGTGTCACTTTTGAAAACTGG + Intergenic
1076614624 10:131747407-131747429 CTGGGGACAGTGTTGAACACTGG - Intergenic
1077321017 11:1942025-1942047 ATGGAGGCACTGTTGAGCCCTGG + Intergenic
1077856440 11:6130981-6131003 GTGGGGTCACTGTTAAAAACAGG - Intergenic
1080335176 11:31187017-31187039 ATAGTGTCACTGTTTTACGCTGG - Intronic
1084569363 11:69950271-69950293 AGGGTGTCGCTGTTGAACACTGG + Intergenic
1085535388 11:77214255-77214277 ATGGTTCCACTGTTGAACTCGGG - Intronic
1091262651 11:134246279-134246301 ATGGCGGCAGTGTTGAACCCAGG + Exonic
1091308470 11:134556217-134556239 GTGGTGTCCCTGCTGAACACTGG + Intergenic
1094242486 12:28244559-28244581 ATGATGTGAACGTTGAACACTGG + Intronic
1095272615 12:40237586-40237608 ATGGTATCATTGATGAAGACAGG + Intronic
1095363123 12:41368184-41368206 AGGGTGCCACTGTTGAAAATAGG + Intronic
1095792098 12:46178597-46178619 ATGATGTCCTTGTTGAACACCGG - Intergenic
1097030165 12:56084072-56084094 ATGGTCTCACTGTTGTAGCCAGG + Intronic
1097973955 12:65664880-65664902 ATGGTGGAACAGTTGAATACAGG - Intergenic
1102237732 12:111304740-111304762 CAGGTGTCGCTGTTGAACACCGG + Intronic
1103834607 12:123808837-123808859 ATGGTTTCAGTGTGGAACAGAGG - Exonic
1104156655 12:126139542-126139564 ATGGTGTCATTGTTGAAGAGTGG - Intergenic
1108309128 13:49168545-49168567 AAGGTGACACTATTGAAAACAGG + Intronic
1109765846 13:66896039-66896061 ATGGTGTCAGTGTTGGTCGCAGG - Intronic
1110017919 13:70432414-70432436 GTGATGTCAGTGTTGAAAACAGG + Intergenic
1113230098 13:108204210-108204232 ATGGTGCCACTTTGGAAAACTGG - Intergenic
1114744489 14:25132985-25133007 ACGGTGGCACTGTTGAAGACTGG - Intergenic
1116202851 14:41821556-41821578 CTGGTATCCCTGATGAACACAGG - Intronic
1122057292 14:99110659-99110681 ATGCTCTCAGTGTTGAACAAGGG + Intergenic
1128418591 15:67469883-67469905 AATGTGTCACAGTTAAACACAGG - Intronic
1133515578 16:6505862-6505884 CTGGTGCCACTGTTAAACAATGG + Intronic
1133975385 16:10596561-10596583 ATCGTGTCACTGTTGCACTTTGG + Intergenic
1134394258 16:13848562-13848584 ATGCTGTCACTGTGGAACACTGG - Intergenic
1135267528 16:21040279-21040301 CTGATGTCCATGTTGAACACTGG - Intronic
1141759656 16:86019594-86019616 ACTGTGTCGCTGTTGAACACTGG + Intergenic
1141894313 16:86948805-86948827 GTGATGTCACTGCTGAACGCGGG - Intergenic
1144233380 17:13231619-13231641 ATGGTATCACAGTTCAAGACAGG + Intergenic
1144768136 17:17744088-17744110 ATGGTGGCACTGGTGCATACGGG + Intronic
1144837902 17:18167093-18167115 GTGGTGTCACTGTTGAAGCATGG + Intronic
1145794235 17:27646238-27646260 AGGATGTCACTATTGATCACAGG + Intronic
1146083141 17:29801311-29801333 ATGCTGTCAGCCTTGAACACTGG + Intronic
1146115074 17:30128731-30128753 ATGCTTTCACTGTTGAAAGCTGG - Intronic
1148009874 17:44469597-44469619 ATTTTGTCACTGTTGAAAATGGG - Intronic
1152580324 17:81162899-81162921 GAGGTGTCACTGTTGACCAGTGG - Intronic
1153736734 18:8078455-8078477 ATGGAGTCACATTTGAATACTGG + Intronic
1156803521 18:41147933-41147955 ATGGAGTCATTGATAAACACAGG + Intergenic
1158698046 18:59719984-59720006 ATGATGTCACTGCTGAAGGCAGG - Intergenic
1158932447 18:62334874-62334896 ATGGTGTCACTAATGCACAGTGG + Intronic
1161059232 19:2206811-2206833 ATGTTGTTAATGATGAACACGGG + Intronic
1162612974 19:11770521-11770543 ATGGTTTCACTGTTGAATTCTGG - Intronic
1162688709 19:12410964-12410986 ATGGTTTCACTGGTGAACTCTGG + Intronic
1164714323 19:30380355-30380377 GTGGTGTCAGTGTTGGAGACGGG + Intronic
927001986 2:18805505-18805527 AATGTGTCTTTGTTGAACACTGG - Intergenic
928666903 2:33558696-33558718 CTGGAGTCACTGCTGGACACAGG + Exonic
929247250 2:39716039-39716061 ATGTTGTCTCTGTTGTATACAGG + Intronic
929556258 2:42927405-42927427 CTGGGCTCATTGTTGAACACTGG - Intergenic
932504948 2:72219907-72219929 ATGGAGACACAGTTGAAGACGGG + Intronic
932784280 2:74586347-74586369 AGGGAGTCACTGTTCAACTCAGG - Intronic
933765869 2:85708952-85708974 ATGGTGCCACTTTTGAAGAGTGG - Intergenic
935201789 2:100863042-100863064 ATGGTGGCACTGCTGTGCACGGG - Intronic
935236073 2:101139261-101139283 ATGGAGTCTCTGTTGAATGCTGG - Intronic
941008136 2:160268651-160268673 ATGTTTTCATTGTTGAAAACTGG + Intronic
943999792 2:194819124-194819146 ATGATGTTTCTGTTGAACAAAGG - Intergenic
1168863114 20:1060312-1060334 ATGGTGCCTCTGTTGAACCCTGG - Intergenic
1169028225 20:2387392-2387414 ATGGGGTCACTGTTGAACACTGG + Intronic
1169892698 20:10470932-10470954 GTGGTTTCACTTTTGAAAACTGG + Intronic
1170654133 20:18269831-18269853 AAGGTTTCACTGTGGAATACAGG + Intergenic
1172887803 20:38243035-38243057 ATGGTGTCACTGTTGAACACTGG - Intronic
1176254664 20:64145653-64145675 AAGGTGTCGCCGTGGAACACCGG - Intergenic
1176517725 21:7798709-7798731 ATGGGGACGCTGTTGAACACCGG + Intergenic
1177754120 21:25323543-25323565 ATGCAGTCCCTGTGGAACACAGG + Intergenic
1179513525 21:41891248-41891270 ATGATGTCCCTGTTGTCCACAGG + Intronic
1180237616 21:46473427-46473449 ATGGTCTCACTGTGGCACCCAGG - Intronic
1181256149 22:21564059-21564081 ATGGTCTCACTCTTTCACACAGG + Intronic
1182255870 22:29037931-29037953 AGGGTGTGACTGCAGAACACAGG - Intronic
1182528662 22:30938148-30938170 TTGGTGTCAACATTGAACACCGG - Exonic
949122378 3:402267-402289 ATTGTGTTACTGTTAACCACTGG + Intronic
949932225 3:9088112-9088134 ATGGTGTCGCTGGAGATCACAGG - Intronic
950732624 3:14974627-14974649 ATGGTCTCACTGTTTCACCCAGG + Intronic
952362365 3:32643568-32643590 ATGGTGTAACTGTTGACCAAGGG - Intergenic
953097961 3:39797637-39797659 ATGGTGGGGCTGTTGAAGACTGG + Intergenic
953158542 3:40396823-40396845 GTGATGTCACTGTTGAAGATGGG + Intronic
953479456 3:43237836-43237858 ATGATGTCAATGTTGAACACTGG + Intergenic
955252973 3:57303435-57303457 AAGGTCTCACTGTGTAACACAGG + Intronic
959433192 3:106280975-106280997 TTGGTGTCACTTTTGGATACTGG + Intergenic
961110859 3:124281956-124281978 ATGCACTCACTGTTGAAAACTGG + Intronic
962831796 3:139148454-139148476 ATGGTGACACTGTGGAGCAGTGG + Intronic
963102766 3:141622373-141622395 AGGGTGTCACTGATACACACAGG + Intergenic
964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG + Intronic
967915311 3:194573955-194573977 ATGGTGTCACTGTCAGTCACTGG - Intergenic
969402824 4:6968256-6968278 ATGGGGACACTGTTGGGCACGGG - Intronic
970660903 4:18284711-18284733 AGGATGTCACTGTTGTTCACAGG + Intergenic
971140074 4:23915434-23915456 ATGGTGTTACTATTGAATAAGGG - Intergenic
980384553 4:132070168-132070190 ATGTTGCAACTGTTTAACACTGG + Intergenic
982570565 4:157045701-157045723 ATGGTGTCCCTGTTGACAACTGG - Intergenic
986067550 5:4250322-4250344 AAGGCCTCACTCTTGAACACAGG - Intergenic
987059874 5:14232369-14232391 TAGGTGTCACTGTTGCAGACAGG + Intronic
991499444 5:67262463-67262485 ATGGTGACACTCTTTGACACAGG - Intergenic
991726626 5:69542052-69542074 AGGGTCTCACTGTTTCACACAGG + Intronic
991868331 5:71085822-71085844 AGGGTCTCACTGTTTCACACAGG - Intergenic
996644405 5:125796667-125796689 ATGGTCTGACTGTGGGACACAGG - Intergenic
997674851 5:135705294-135705316 ATGCTGTCACTGTTGATAAATGG + Intergenic
998266510 5:140671287-140671309 ATGGAGTCACTGTTTAACCATGG + Exonic
1000409899 5:160927378-160927400 ATGCTGTCGCTTTTGAAGACTGG + Intergenic
1002827388 6:785699-785721 AGGATGTAAATGTTGAACACAGG - Intergenic
1004774194 6:18823973-18823995 ACGGTGGCGCTGTTGAACACTGG - Intergenic
1008022137 6:46590943-46590965 ATGGTGGCACTATTTACCACAGG - Intronic
1008320432 6:50105522-50105544 ATGGTCTGACTGTGGAACACAGG + Intergenic
1010608543 6:77922944-77922966 ATCCTGTCACTGGTGAACAAGGG - Intronic
1013482252 6:110562851-110562873 ATGGTGTCACAGTTGAATACTGG - Intergenic
1014544107 6:122712719-122712741 ATGGTTTCACTGTGGAAGATAGG + Intronic
1015264054 6:131271939-131271961 ATGGTTGCACTGTGGAACACTGG - Intronic
1015325946 6:131923558-131923580 AAGGTGTCGCTGTTGGACATGGG + Intergenic
1015386117 6:132625524-132625546 CAGGTGTCACTGTTGAAAATAGG - Intergenic
1015617129 6:135089198-135089220 ATGGTTTCACATTTGAACTCTGG + Intronic
1016357896 6:143237898-143237920 TTGGTGACACTGTTGAGCAATGG - Intronic
1018407428 6:163502295-163502317 AGGGTCTCACTGTTTAACCCAGG - Intronic
1019257974 7:63756-63778 ATGGTGACACTGAAGAGCACTGG - Intergenic
1026428549 7:70320936-70320958 CTGGTGTCACTGTTGATTTCTGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1031100376 7:117472517-117472539 ATTGTGTCACTGATGAAAATAGG + Intronic
1032404779 7:131648305-131648327 ATGGTCTCCCCGTTGGACACTGG + Intergenic
1040483891 8:47852272-47852294 TTGGTGTAGCTGTTGAACAGGGG - Intronic
1042947716 8:74171566-74171588 ATGGTGTCACTGTTGAACACTGG - Intergenic
1045395470 8:101756452-101756474 ACAGTGGCGCTGTTGAACACGGG - Intronic
1045744443 8:105400843-105400865 CCGGTGTCAATGTTGAGCACTGG - Intronic
1047793290 8:128227883-128227905 ATGGTGTCACAGTTTCACAATGG - Intergenic
1047980680 8:130178468-130178490 ATGGTGCCAGTGTAGAACAATGG + Intronic
1048165981 8:132061809-132061831 ATGGTATGACTGTAGAAAACTGG + Intronic
1048192974 8:132307228-132307250 ATGGTGTCACTGTGGAACACAGG - Intronic
1048959641 8:139565289-139565311 ATGTAGTCAAGGTTGAACACAGG + Intergenic
1050418937 9:5442588-5442610 ATGGTGTCACCGTTGAGGAATGG - Intergenic
1053625788 9:39868817-39868839 ATGGACTCACAGTTCAACACAGG - Intergenic
1054218100 9:62381884-62381906 ATGGACTCACAGTTCAACACAGG + Intergenic
1055207745 9:73752771-73752793 ATGCTTTCACTCTTGTACACTGG + Intergenic
1058832959 9:108835801-108835823 ATGCAGTCACTGATGAACCCAGG + Intergenic
1060439418 9:123625313-123625335 TAGCTGCCACTGTTGAACACTGG - Intronic
1060726484 9:126009246-126009268 ACGGTGCCACTGTTGAAGACTGG - Intergenic
1187170812 X:16849958-16849980 GTGATTTCACTGTTGAGCACTGG - Intronic
1197326066 X:125095114-125095136 ATGGTGTCAATCATGAACTCAGG + Intergenic