ID: 1042952850

View in Genome Browser
Species Human (GRCh38)
Location 8:74219555-74219577
Sequence TAATATATGCACAGGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042952846_1042952850 10 Left 1042952846 8:74219522-74219544 CCATGAAAAGAGAAATGCTGTAA No data
Right 1042952850 8:74219555-74219577 TAATATATGCACAGGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042952850 Original CRISPR TAATATATGCACAGGGTGTA AGG Intergenic
No off target data available for this crispr