ID: 1042953742

View in Genome Browser
Species Human (GRCh38)
Location 8:74226549-74226571
Sequence AAGAATAAGCATGGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042953735_1042953742 21 Left 1042953735 8:74226505-74226527 CCCTGATAAACCCATCAGATCTT 0: 184
1: 889
2: 2520
3: 6284
4: 5802
Right 1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG No data
1042953734_1042953742 22 Left 1042953734 8:74226504-74226526 CCCCTGATAAACCCATCAGATCT 0: 699
1: 1030
2: 3869
3: 6945
4: 6387
Right 1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG No data
1042953737_1042953742 11 Left 1042953737 8:74226515-74226537 CCCATCAGATCTTGTGAGACTTA 0: 228
1: 461
2: 727
3: 601
4: 373
Right 1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG No data
1042953738_1042953742 10 Left 1042953738 8:74226516-74226538 CCATCAGATCTTGTGAGACTTAT 0: 1337
1: 2885
2: 5481
3: 5461
4: 4813
Right 1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG No data
1042953736_1042953742 20 Left 1042953736 8:74226506-74226528 CCTGATAAACCCATCAGATCTTG 0: 192
1: 530
2: 1904
3: 2933
4: 4526
Right 1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042953742 Original CRISPR AAGAATAAGCATGGGGAAGA TGG Intergenic
No off target data available for this crispr