ID: 1042956882

View in Genome Browser
Species Human (GRCh38)
Location 8:74260414-74260436
Sequence CTGGTTTATCTGCTCTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042956880_1042956882 7 Left 1042956880 8:74260384-74260406 CCAGAGAGGGTTGGAGGGAAGAA 0: 1
1: 0
2: 2
3: 37
4: 304
Right 1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG No data
1042956878_1042956882 9 Left 1042956878 8:74260382-74260404 CCCCAGAGAGGGTTGGAGGGAAG 0: 1
1: 0
2: 2
3: 36
4: 374
Right 1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG No data
1042956879_1042956882 8 Left 1042956879 8:74260383-74260405 CCCAGAGAGGGTTGGAGGGAAGA 0: 1
1: 0
2: 1
3: 35
4: 357
Right 1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG No data
1042956872_1042956882 30 Left 1042956872 8:74260361-74260383 CCAGGGAATGATGTCTACTGGCC 0: 1
1: 0
2: 1
3: 10
4: 87
Right 1042956882 8:74260414-74260436 CTGGTTTATCTGCTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042956882 Original CRISPR CTGGTTTATCTGCTCTGCAA AGG Intronic
No off target data available for this crispr