ID: 1042958310

View in Genome Browser
Species Human (GRCh38)
Location 8:74275775-74275797
Sequence CAGTTTTTCTTCACAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042958309_1042958310 -4 Left 1042958309 8:74275756-74275778 CCTTTAATGTAACAGTCATCAGT 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG No data
1042958307_1042958310 15 Left 1042958307 8:74275737-74275759 CCTTAAAGGAACTTCCAATCCTT 0: 1
1: 0
2: 1
3: 31
4: 184
Right 1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG No data
1042958308_1042958310 1 Left 1042958308 8:74275751-74275773 CCAATCCTTTAATGTAACAGTCA 0: 1
1: 0
2: 1
3: 6
4: 146
Right 1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042958310 Original CRISPR CAGTTTTTCTTCACAGAACA AGG Intronic
No off target data available for this crispr