ID: 1042958828

View in Genome Browser
Species Human (GRCh38)
Location 8:74280812-74280834
Sequence ATGCTCCGTAATTGCAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042958828_1042958831 28 Left 1042958828 8:74280812-74280834 CCTGCCTTGCAATTACGGAGCAT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1042958831 8:74280863-74280885 TTATGAACAAATCATTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042958828 Original CRISPR ATGCTCCGTAATTGCAAGGC AGG (reversed) Intronic
903008506 1:20314306-20314328 ATGTTCCCTAAGTGCCAGGCTGG - Exonic
910331206 1:86073943-86073965 ATGCTCCCTCCTTGTAAGGCAGG - Intronic
911873773 1:103132936-103132958 ATACCCAGTAATTGCACGGCTGG + Intergenic
923396424 1:233569295-233569317 ATGCTCCATACTTGCAAAGAGGG + Intergenic
1063309881 10:4942182-4942204 ATGCTCCATAGTTACATGGCAGG - Intronic
1063317413 10:5019916-5019938 ATGCTCCATAGTTACATGGCAGG + Intronic
1063330711 10:5156156-5156178 AGGCTCTGTCATTCCAAGGCTGG - Intergenic
1075242081 10:120788179-120788201 AGGCTCCGTCTTTGCAAAGCTGG + Intergenic
1080488970 11:32742168-32742190 ATGCCCAGTAATGGCATGGCTGG + Intronic
1090905106 11:131068060-131068082 ATGCTCTGTAATAGCACTGCTGG - Intergenic
1096985919 12:55757392-55757414 ATGCTCCCTCATTGCGAGGCAGG + Exonic
1097109116 12:56645208-56645230 ATGCCCTGGAAGTGCAAGGCAGG - Exonic
1122043560 14:99007583-99007605 AGGCTCAGTAATAGCCAGGCAGG - Intergenic
1123043477 14:105499996-105500018 ATGCACCGGAATGGGAAGGCAGG - Intergenic
1129109301 15:73328378-73328400 ATGCTCCTCAAATGCCAGGCTGG + Intronic
1130818780 15:87469218-87469240 ATACTCAGTAATTGGATGGCTGG - Intergenic
1131298809 15:91176400-91176422 ATACCCCGTAATTGGATGGCTGG + Intronic
1137443101 16:48512548-48512570 AAGCTCCTTACTTGCCAGGCTGG - Intergenic
1143718410 17:8792853-8792875 ATGGTGCTTAAATGCAAGGCTGG - Intergenic
1149279448 17:55086190-55086212 ATACTCAGTAATTTCCAGGCTGG + Intronic
1150623566 17:66826110-66826132 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1155583147 18:27335024-27335046 ATGCACAGAAATTGCAAGGCAGG - Intergenic
1161476961 19:4491523-4491545 ATGCTCAGTGATGGGAAGGCCGG - Intronic
1168427819 19:56253042-56253064 CAGCTCCGTGATTGCAGGGCCGG + Intronic
927517987 2:23683025-23683047 CTGCTCCCTGATTGCCAGGCAGG - Intronic
932871876 2:75409123-75409145 ATGTTCCATAATGGCAGGGCTGG - Intergenic
932899809 2:75684686-75684708 ATACTCAGTAATAGCATGGCTGG - Intronic
935593574 2:104862892-104862914 TTGATCTGTAATTGAAAGGCAGG - Intergenic
940827443 2:158428767-158428789 ATGCTCAGTAATGGGAAGCCTGG - Intronic
946878881 2:224158058-224158080 ATGATACGTACTTTCAAGGCTGG - Intergenic
958508754 3:95017099-95017121 ATACTGAGTAATGGCAAGGCTGG - Intergenic
967918037 3:194593473-194593495 ATACCCCATATTTGCAAGGCAGG - Intronic
974530611 4:63102526-63102548 ATACTCAGTAATTGGATGGCTGG - Intergenic
977554201 4:98472168-98472190 ATCTTCCGTAATTGGAGGGCTGG - Exonic
983788548 4:171764549-171764571 ATGCGCAGTAATGGGAAGGCTGG - Intergenic
989457078 5:41656825-41656847 CTGCTCAGTAATTACAAGGTGGG + Intergenic
993787855 5:92165988-92166010 ATGCCCCGTAATGGGATGGCTGG + Intergenic
995529681 5:113080284-113080306 ATGCTCAGTAATGGGATGGCTGG - Intronic
999747899 5:154606132-154606154 AGGATCCATAATTGCATGGCTGG + Intergenic
1013291215 6:108720282-108720304 ATGCTCCGAAAGTCCAAGGTGGG + Intergenic
1013630670 6:111983136-111983158 ATGCACAGTAAATGCAAGGATGG + Intergenic
1014585084 6:123188096-123188118 ATGCTCAGTAATTGGATTGCTGG - Intergenic
1015005280 6:128272840-128272862 ATGCTCAGTAATGGGATGGCTGG - Intronic
1015374484 6:132493941-132493963 ATGCTCAGTAATTGTATGACAGG - Intronic
1016378366 6:143447877-143447899 ATGCTCAGTAATGGGATGGCTGG - Intronic
1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG + Intronic
1021528315 7:21614071-21614093 ATGCTTTGGAATTGCGAGGCTGG - Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1027532272 7:79351406-79351428 ATGCTCGTTAATAGCAAGGCTGG - Intronic
1028759592 7:94480608-94480630 ATCCTCCATATTTGCAAGCCTGG + Intergenic
1028868289 7:95737892-95737914 ACTCTCCCTAATTGCAAGCCTGG + Intergenic
1033570281 7:142620907-142620929 AGGCTCCGTAAGTGCAGGTCTGG + Intergenic
1034543467 7:151775017-151775039 ATCCTCCTTAATGTCAAGGCTGG + Intronic
1040099495 8:43485671-43485693 ATGCTCAGTAATGGGATGGCTGG - Intergenic
1041841636 8:62278888-62278910 ATGCCCAGTAATTGGATGGCTGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1045371460 8:101528543-101528565 ATGTGCCCTCATTGCAAGGCAGG + Intronic
1045715521 8:105039148-105039170 ATACTCCGTAATGGCATTGCTGG - Intronic
1045788994 8:105958922-105958944 ATACTCAGTAATGGCATGGCTGG - Intergenic
1055218446 9:73897112-73897134 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1055367751 9:75563257-75563279 ATGCTCAGTAATGGGATGGCTGG + Intergenic
1056045795 9:82714231-82714253 AAGCTCCATTATTGCAAAGCAGG + Intergenic
1056361522 9:85862269-85862291 ATGCTCAGTAATGGCATGGCTGG + Intergenic
1062427953 9:136514696-136514718 ATGCTCCCTAAGGGCAGGGCGGG + Exonic
1185890769 X:3819912-3819934 AAACTCTGTATTTGCAAGGCGGG + Intronic
1185890917 X:3821341-3821363 AAACTCTGTATTTGCAAGGCGGG + Intronic
1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG + Intronic
1196733537 X:118964341-118964363 ATGCTCAGCAATTACAGGGCAGG + Intergenic