ID: 1042958965

View in Genome Browser
Species Human (GRCh38)
Location 8:74282211-74282233
Sequence ATCTCAGTGATTTAAGGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042958965 Original CRISPR ATCTCAGTGATTTAAGGTAG TGG (reversed) Intronic
901888522 1:12241470-12241492 ATGGCAGTGATTTAAGGATGGGG + Intronic
901901571 1:12368100-12368122 ATATCAGTGAATAAATGTAGAGG - Intronic
902970305 1:20043518-20043540 ATATCTGTGGGTTAAGGTAGTGG + Intronic
904313819 1:29646875-29646897 ATCTCAGTGATTTCAGCTTTGGG + Intergenic
904675489 1:32196784-32196806 ATCTGAGAGATTTAAGGTAAGGG - Exonic
904758219 1:32781207-32781229 ATCTCAGTGTCTTAACGTGGTGG - Intronic
906055221 1:42910713-42910735 ATCTCTCTGGTTTAATGTAGAGG - Intergenic
908542427 1:65134330-65134352 ATCTCATTCATGTAAGGCAGAGG - Intergenic
908774318 1:67625662-67625684 ATTTCCGTGATTTAAGACAGTGG + Intergenic
909899864 1:81119586-81119608 ATTTCAGTGGTTTAAGGCAATGG - Intergenic
910364580 1:86450890-86450912 TCCTCAGTGATTCATGGTAGGGG + Intronic
913657176 1:120972338-120972360 TTCTCAGTTGTTTAAGGTGGAGG + Intergenic
914008520 1:143755422-143755444 TTCTCAGTTGTTTAAGGTGGAGG + Intergenic
914647150 1:149664073-149664095 TTCTCAGTTGTTTAAGGTGGAGG + Intergenic
916045013 1:160993177-160993199 CCCTCAGAGATTTAAGGAAGGGG - Intergenic
917260635 1:173164202-173164224 ATCTCAGTGACTTAAAATATTGG + Intergenic
918534502 1:185559382-185559404 ATTTAAGTGATTTAAGTTACAGG - Intergenic
918709546 1:187709939-187709961 ATCTCAGTAAGTTCAGGTTGTGG + Intergenic
918977238 1:191505297-191505319 ATTTCAGTGCTGTAAGGTTGTGG - Intergenic
919840635 1:201606624-201606646 ACTTCAGGGATTTAAGTTAGAGG - Intergenic
1064677877 10:17780099-17780121 GCTTCAGTGATTTCAGGTAGTGG + Intronic
1067979488 10:51068333-51068355 ATGTCAGTGATTCAAGGGAGAGG - Intronic
1068019431 10:51562491-51562513 ATCTTTGTGTTATAAGGTAGAGG + Intronic
1070738234 10:78880796-78880818 ATCTCACTAAATTAAGATAGTGG + Intergenic
1073889268 10:108079926-108079948 ATCTCTGTGAGTTAACGTAAAGG + Intergenic
1073966004 10:108990721-108990743 ATCTTAGTGGTATAAGTTAGAGG + Intergenic
1075008333 10:118846453-118846475 ATCTCAGGCATTTCAGGTAAGGG - Intergenic
1075241881 10:120786628-120786650 ATCTCAGTGATTTAGGTGGGAGG - Intergenic
1076145104 10:128112604-128112626 GTCTCAGTCATTTAAGGAAAAGG + Intronic
1076439312 10:130469614-130469636 ATGGCAGTGGTTTAAGGCAGGGG - Intergenic
1077053537 11:578586-578608 ATCTCAGTGCATCAAGGGAGAGG + Intronic
1080024795 11:27601890-27601912 GTCTCAGTGATTTTAGTTAATGG + Intergenic
1083092876 11:60219038-60219060 ATCTCCTTGGTTTAATGTAGAGG + Intronic
1086877947 11:92120519-92120541 ATCTCATTGATACCAGGTAGTGG + Intergenic
1087689296 11:101301024-101301046 ATCTCAGGGATTTAAAATAAAGG - Intergenic
1090786701 11:130055332-130055354 ATCTCAGTGATTCGAGGAATAGG + Intergenic
1091061898 11:132471462-132471484 GTCTCAGTGTTATAAGGTTGTGG + Intronic
1091639553 12:2224974-2224996 AACTCAGACATTTAAGGTTGTGG + Intronic
1099812752 12:87605603-87605625 ATTTCCTTGATGTAAGGTAGAGG - Intergenic
1100710914 12:97256014-97256036 ATCTAAGAGAATTCAGGTAGTGG - Intergenic
1116958993 14:50951176-50951198 CTGTCAGTGATTTGAGGGAGAGG - Intergenic
1119982549 14:79098268-79098290 ATCTCCCTGTTTTAAAGTAGAGG - Intronic
1120655209 14:87181104-87181126 TCCTATGTGATTTAAGGTAGGGG - Intergenic
1121869864 14:97397210-97397232 ATCACAGTGATATAAGTTTGGGG - Intergenic
1124043324 15:26125012-26125034 ATCCGAGTGTTTTAATGTAGGGG - Intergenic
1124867783 15:33510282-33510304 ATCTAAGTGATGTCATGTAGAGG - Intronic
1125834767 15:42739258-42739280 ATCTCTCTGATTTCAGGAAGAGG + Exonic
1127517986 15:59714752-59714774 ACCTCACTGATTTAAAATAGGGG + Intergenic
1128078655 15:64843296-64843318 CTCTCAGTGGGTGAAGGTAGGGG + Intronic
1128443743 15:67738420-67738442 CACTCAGTGATTCAGGGTAGAGG + Intronic
1129131216 15:73498343-73498365 AAGTTTGTGATTTAAGGTAGGGG + Intronic
1130969208 15:88718902-88718924 ATGTCAGTGCTTTCAGGCAGAGG - Intergenic
1138861975 16:60769544-60769566 ATCTCAGTAAGTTAGGGAAGAGG - Intergenic
1140255144 16:73329289-73329311 ATCTCAAGGATTTTAGGCAGTGG + Intergenic
1151033825 17:70774597-70774619 AGCTAAGTGTTTTAGGGTAGAGG - Intergenic
1151456854 17:74231706-74231728 AGCCCCGTGATGTAAGGTAGTGG + Intronic
1153648632 18:7218933-7218955 ATCTCAGGGATGCAAGGAAGTGG - Intergenic
1155827327 18:30464085-30464107 ATCTTACTGCTTTATGGTAGTGG - Intergenic
1156404919 18:36774464-36774486 ATGACAGTGATTTAAGTGAGGGG + Intronic
1156928021 18:42606542-42606564 ATCTCAGTGATATCAGTTAAGGG + Intergenic
1158349562 18:56551146-56551168 ATTGCAGTGATCTAAGGCAGTGG - Intergenic
1165556621 19:36638330-36638352 ATCTCAGAGATTTGAGGGAAGGG + Exonic
1167522167 19:49961423-49961445 AACACAGTGATTTATGGTGGGGG + Intergenic
926868193 2:17383086-17383108 ATCTCATTGGTTTAAAGTTGAGG - Intergenic
927955880 2:27207094-27207116 TTCTCAGTGATGTTAGGTATAGG - Intronic
928433922 2:31241456-31241478 ATCTAGGTAATTTAAGGTACTGG + Intronic
929880592 2:45833658-45833680 ATCTCAGAGATTGAAAGTAAAGG - Intronic
930897684 2:56464417-56464439 TTCTCAGTGTTTTAAGGGTGGGG - Intergenic
935903814 2:107821558-107821580 ATCTGAGTAATTTAAGATTGAGG - Intergenic
935916020 2:107950532-107950554 ATCTGAGTAATTTAAGATTGAGG + Intergenic
936557168 2:113506507-113506529 ATCTCAGAGATTCCAGATAGTGG - Intergenic
936605997 2:113954865-113954887 TTCTCAGTGATTAGAGCTAGGGG + Intronic
936947516 2:117943853-117943875 AACTCAGTGATTTAAGATGTTGG - Intronic
937237437 2:120439119-120439141 GTGTCAGTGAGTTAAGGTGGGGG - Intergenic
937785472 2:125889787-125889809 ATCTCCTTGGTTTAATGTAGAGG - Intergenic
940767943 2:157810166-157810188 ATCACAGTGTTTGAAGGTTGTGG - Intronic
943906965 2:193511803-193511825 ATGTGAGTGCTTTATGGTAGTGG + Intergenic
946068010 2:217006560-217006582 ATCACAGTGATTAAATGCAGTGG - Intergenic
946528136 2:220542034-220542056 GTCTCCTTGATTTAATGTAGTGG - Intergenic
1169919772 20:10722625-10722647 ATCTCACTGATTTAAAATATGGG - Intergenic
1170760672 20:19247967-19247989 CTCTCAATCATCTAAGGTAGAGG - Intronic
1174537449 20:51262430-51262452 CTCTCATTGATATAAGGCAGGGG + Intergenic
1179431429 21:41323788-41323810 ATCTCAGTGAAGCAAGGGAGTGG + Intronic
1182192648 22:28478782-28478804 ACCTCAGTGAGCTAAGGCAGAGG - Intronic
951787520 3:26438636-26438658 TTCTGGGTGATTTCAGGTAGGGG - Intergenic
953099696 3:39811853-39811875 AGCTCAGTCATTTAAACTAGCGG + Intronic
953651140 3:44806006-44806028 ATTGCACTGATTTAAGGTGGAGG - Intronic
955126694 3:56119170-56119192 ATCTCAATGGTTTAAAGCAGAGG - Intronic
964061937 3:152535974-152535996 ATTTCAGTGTGTTATGGTAGTGG + Intergenic
965235064 3:166107971-166107993 ATCTCAGACATTTTAGCTAGTGG + Intergenic
967867398 3:194201732-194201754 ATCTCAGTGAGTTAGTTTAGTGG - Intergenic
970671871 4:18405964-18405986 ATCACAGACATTGAAGGTAGAGG + Intergenic
972987862 4:44786937-44786959 ATCTCAGTGATATAATGTATGGG + Intergenic
973039734 4:45455538-45455560 ATCTAAGTCATTATAGGTAGGGG - Intergenic
973533394 4:51855743-51855765 ATCTCAGTGATTCAAGTAAAAGG + Intronic
974179304 4:58363290-58363312 ATGACAGTGAATTAAGGAAGGGG + Intergenic
974945185 4:68518344-68518366 TTGTAAGTGATTTGAGGTAGAGG + Intergenic
974955095 4:68629617-68629639 TTGTAAGTGATTTGAGGTAGAGG + Intronic
976111904 4:81684645-81684667 ATCTCGGTGTCTTAAGGCAGTGG - Intronic
978850509 4:113330519-113330541 ATCCTAGTGATTTCATGTAGAGG - Intronic
979970760 4:127131820-127131842 AAGTCAGGGCTTTAAGGTAGAGG - Intergenic
980027120 4:127781058-127781080 ATCTAAGTTATTTAAAGAAGTGG + Intergenic
982539408 4:156649261-156649283 ATATCAGTGAATTAAGGATGGGG + Intergenic
984043640 4:174770142-174770164 ATCTTGCTGAATTAAGGTAGAGG + Intronic
989425628 5:41292422-41292444 ATCTTATTGATTTAATATAGTGG + Intergenic
990157568 5:52896399-52896421 ATCTCAGTCATTTAAATTACAGG + Intronic
990289396 5:54333334-54333356 TTCTATGTGATTTAAGATAGGGG - Intergenic
991356224 5:65771943-65771965 TTGTCATTGTTTTAAGGTAGTGG - Intronic
993360579 5:86970473-86970495 ATCTCAGTGAATGGAGGTAATGG + Intergenic
994112681 5:96024891-96024913 ATCTCATTGATTCCAAGTAGAGG + Intergenic
994443616 5:99843110-99843132 ATCTGAGTGACTTAAGGGATGGG - Intergenic
997619687 5:135278284-135278306 ATCTCAAAGATTTAAAGAAGTGG - Intronic
998261276 5:140633524-140633546 TTCTCTGGGATATAAGGTAGGGG - Exonic
999014110 5:148079152-148079174 ATCTAAGTTATTTAATGTGGTGG - Intronic
999481739 5:151954637-151954659 ATCTCAGTGTTGTAAGAGAGAGG + Intergenic
1001152293 5:169242689-169242711 ATCTCAGTGACTTAACACAGTGG - Intronic
1001327694 5:170741283-170741305 ACCACAGTGATTCAAGGCAGAGG + Intergenic
1002397387 5:178968722-178968744 TTCTCAGGGATTCAAGGTAAGGG - Intergenic
1003181496 6:3795717-3795739 TTCTCTGCTATTTAAGGTAGGGG - Intergenic
1003503638 6:6722900-6722922 ATGTCAGGGATTCAAAGTAGAGG + Intergenic
1005075594 6:21903486-21903508 ATCCCAGTGATTATAGGCAGGGG + Intergenic
1005441287 6:25871709-25871731 ATCTAAGTTATCTAAGGAAGGGG - Intronic
1006396739 6:33792185-33792207 ATCTCAGTGCCTTATGGAAGAGG + Intergenic
1008203680 6:48626044-48626066 ATGTGAATGATGTAAGGTAGCGG + Intergenic
1009719527 6:67449334-67449356 ATTGCAGTGATTTAAGAAAGAGG - Intergenic
1011498359 6:87961103-87961125 ATCTCAGGAATTCAAGGTATGGG - Intergenic
1011902044 6:92311051-92311073 ATTTAAGTGATTTAATGCAGAGG - Intergenic
1013468322 6:110437081-110437103 ATCTCAGTGACTTAACATAAAGG - Intronic
1013839075 6:114368603-114368625 TTATAAGTGATTTAAGGTAAGGG - Intergenic
1026418113 7:70204108-70204130 ATACCAGTGATGTAAGATAGTGG + Intronic
1028070628 7:86445799-86445821 ATCTCAGTGATTTACAGTAATGG - Intergenic
1028789642 7:94839168-94839190 TTGTCAGGGATTTAAGGGAGAGG - Intergenic
1029349828 7:100005235-100005257 ATCTCCATGATTTCAGCTAGTGG - Intergenic
1029895014 7:103974392-103974414 CTCTCAGGGATTTGTGGTAGTGG - Intronic
1036410879 8:8499244-8499266 GTCCCAGTGATGTAAGGAAGGGG - Intergenic
1037189917 8:16111898-16111920 AAGTCATTGATTTAAGGCAGTGG - Intronic
1040559126 8:48508418-48508440 ATCTCAGGGTTTTAATGCAGTGG + Intergenic
1042661275 8:71157276-71157298 ATGTAAGTGATTTCAGTTAGAGG - Intergenic
1042958965 8:74282211-74282233 ATCTCAGTGATTTAAGGTAGTGG - Intronic
1044164007 8:88957796-88957818 ATCTTAGTAATTTCAGGAAGTGG - Intergenic
1046315807 8:112500392-112500414 GACCCAGTGATTTAAGGTGGTGG - Intronic
1046541122 8:115585208-115585230 AAATCAGGGATTTAAGGAAGTGG + Intronic
1048578543 8:135711778-135711800 ATCTCAGTGATTAAAGCTTTCGG + Intergenic
1049600776 8:143506416-143506438 ATCACAGTGATTTAGTGTGGGGG + Intronic
1049895829 9:110794-110816 ATCTCAGAGATTCCAGATAGTGG + Intergenic
1050435125 9:5600756-5600778 ACATCAGTGATTTGAGGCAGAGG - Intergenic
1051049829 9:12918545-12918567 ATTTCAGTAATTTAAGTTATTGG - Intergenic
1053266499 9:36718247-36718269 ATCTAAGTCATTTAAGATACAGG - Intergenic
1053401721 9:37830223-37830245 ATCTCAGAAATTTAAAGTTGAGG + Intronic
1053543802 9:39001899-39001921 ACCTCAGTGATTTGAGGAGGTGG - Intergenic
1053739010 9:41120976-41120998 ATCTCAGAGATTCCAGATAGTGG + Intergenic
1053808229 9:41825396-41825418 ACCTCAGTGATTTGAGGAGGTGG - Intergenic
1054622363 9:67362032-67362054 ACCTCAGTGATTTGAGGAGGTGG + Intergenic
1054689339 9:68310346-68310368 ATCTCAGAGATTCCAGATAGTGG - Intergenic
1057972946 9:99574739-99574761 ATTTCAGTGCTTTATAGTAGAGG + Intergenic
1058788032 9:108410790-108410812 CTCCCAGGGATTCAAGGTAGAGG + Intergenic
1060238406 9:121882873-121882895 ATCACAGTCATTTAAGTTTGTGG + Intronic
1190090535 X:47433304-47433326 AGCTATGTGATTTAGGGTAGGGG + Intergenic
1202133402 Y:21635073-21635095 GTGTCACTGTTTTAAGGTAGGGG + Intergenic