ID: 1042960185

View in Genome Browser
Species Human (GRCh38)
Location 8:74295026-74295048
Sequence TTCAAACTTATGTAGGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042960185_1042960188 -2 Left 1042960185 8:74295026-74295048 CCCTGGACCTACATAAGTTTGAA 0: 1
1: 0
2: 1
3: 12
4: 254
Right 1042960188 8:74295047-74295069 AATGACAATAGCACTTTAGCAGG No data
1042960185_1042960189 -1 Left 1042960185 8:74295026-74295048 CCCTGGACCTACATAAGTTTGAA 0: 1
1: 0
2: 1
3: 12
4: 254
Right 1042960189 8:74295048-74295070 ATGACAATAGCACTTTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042960185 Original CRISPR TTCAAACTTATGTAGGTCCA GGG (reversed) Intronic
902108039 1:14054199-14054221 TTCAAACTTATGTTGTTCTAAGG + Intergenic
902185570 1:14722787-14722809 TTCAAACTCACGTAGGAACAGGG - Intronic
907054725 1:51354721-51354743 TTTAATATTATGTTGGTCCACGG + Exonic
909070656 1:70989819-70989841 TTCAATATTTTGTAAGTCCAGGG - Intronic
909142570 1:71887324-71887346 TTCAAATTTATGTTGTTCAAGGG + Intronic
909476552 1:76087319-76087341 TTCAGATTTATGTAGGTTAAAGG + Intronic
909895516 1:81064447-81064469 TTAAAACATATGGATGTCCAGGG - Intergenic
910052712 1:82994508-82994530 TTCAAACCTATGTTGCTCAAGGG + Intergenic
910745162 1:90566074-90566096 TTGAAAATTATGTAGTTCCTTGG - Intergenic
911031056 1:93488707-93488729 ATCAAACATATGTAGGCCCAGGG + Intronic
911065201 1:93781882-93781904 TTCAACTTTATCTAGGTCCTTGG + Intronic
912842378 1:113050477-113050499 TTCATACTTTTGTATTTCCATGG - Intergenic
914329397 1:146652180-146652202 TTCAAACTCATGTTGTTCAAGGG + Intergenic
914732815 1:150387212-150387234 TTCAAACTTGTGTTGTTCAAGGG + Intronic
916152173 1:161805186-161805208 TTTAAAAATATGTAGGTCAACGG - Intronic
916157163 1:161864222-161864244 TTCAAACTTGTGTTGTTCAAGGG - Intronic
916726873 1:167531520-167531542 TTCAAACTCATGTTGCTCAAGGG + Intronic
917016278 1:170534285-170534307 TTCAAACTTGTGTTGTTCAAGGG - Intronic
917381505 1:174414287-174414309 TTCAAACTCATGTTGTTCAAGGG + Intronic
918002043 1:180506540-180506562 TTCAAACTTGTGTTGTTCCAGGG - Intergenic
918654138 1:187003162-187003184 TTCTAAATTATGTAGGTCTGGGG - Intergenic
919331056 1:196172351-196172373 TTCAAACTCATGTTGTTCAAGGG - Intergenic
919717462 1:200794243-200794265 TTCAAACTCATGTTGTTCAAGGG - Intronic
921786179 1:219232551-219232573 TACAAACTTCTGTATGTCAAAGG + Intergenic
921812628 1:219531875-219531897 TTCAAACTCATGTTGTTCAAGGG - Intergenic
923378431 1:233390257-233390279 TTCAAACTTCTGTTGTTCAAGGG - Intergenic
1063085239 10:2811373-2811395 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1066304192 10:34124165-34124187 TGCAAAATTTTGTATGTCCAAGG + Intronic
1066514591 10:36143462-36143484 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1068028461 10:51678444-51678466 TTCAGACTTAAGTAGATCTAGGG - Intronic
1068393517 10:56430060-56430082 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1073078863 10:100843951-100843973 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1073946237 10:108753971-108753993 CTCAAACTTTTGTAGGGCAATGG + Intergenic
1074969614 10:118525253-118525275 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1075133549 10:119762142-119762164 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1075353354 10:121746134-121746156 TTCTATTTTATGTGGGTCCAGGG - Intronic
1077622508 11:3739819-3739841 TTCAAACTTGTGTTGTTCAAAGG - Intronic
1079540915 11:21573633-21573655 GTCAAAATTATGTAGTTCAAAGG - Intronic
1082232951 11:49791590-49791612 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1083830943 11:65233182-65233204 CCCAAACTTCTGCAGGTCCATGG - Intergenic
1086617676 11:88842324-88842346 TTCAAACTCATGTTGTTCAAGGG + Intronic
1087939377 11:104076705-104076727 TTCAAACCTATGTTGTTCAAGGG - Intronic
1090711199 11:129387283-129387305 TTCTGACTTATGTAGTCCCACGG - Intronic
1090888637 11:130902333-130902355 TTCTAAGTTATGTAGGATCAAGG - Intronic
1093698405 12:22189650-22189672 TTCAAACTTTTGTTGTTCAAGGG - Intronic
1093805253 12:23424353-23424375 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1094377593 12:29807197-29807219 TTCAAACTTTTGTTGTTCAAGGG + Intergenic
1094702784 12:32886555-32886577 TTAAAAAATATGTAAGTCCAAGG - Intronic
1096899561 12:54861277-54861299 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1097564081 12:61246484-61246506 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1098701993 12:73640165-73640187 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1099460392 12:82914010-82914032 TTCAAACCTATGTTGTTCAAGGG + Intronic
1099466385 12:82993325-82993347 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1100470235 12:94885481-94885503 ATCAAACATATCTAGGTACATGG - Intergenic
1101076765 12:101138081-101138103 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1103016804 12:117500927-117500949 TTCAGACTGCTGTAGGTCAAGGG + Intronic
1104613229 12:130247031-130247053 TTCAAATTAAGGTAGTTCCAAGG - Intergenic
1105888776 13:24666768-24666790 TTCAAACTGATGTTGTTCAAGGG + Intergenic
1106625451 13:31416551-31416573 TTCAAACCTGTGTTGTTCCAAGG - Intergenic
1107539182 13:41370143-41370165 TTCAAACCTATGTTGTTCAAAGG - Intronic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1108149027 13:47512284-47512306 TTCAAACTTATGCTGTTCAAGGG - Intergenic
1109379519 13:61541535-61541557 TTCAAAATTATTTAGGTCCACGG - Intergenic
1109521535 13:63518096-63518118 TTCAAACTTGTGTTGTTCAAAGG + Intergenic
1110563312 13:76932740-76932762 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1110953507 13:81523362-81523384 TTCAAATTTATGTTGTTCAAGGG - Intergenic
1111152880 13:84281463-84281485 TTCAAACTTTTGTTGACCCAGGG + Intergenic
1111852741 13:93597520-93597542 TTCAAACATATGTTGCTCAAGGG - Intronic
1112879993 13:104095476-104095498 TTCAAACTTGTGTTGTTCCAGGG - Intergenic
1113012503 13:105786122-105786144 TTCAAACCCATGTAGTTCAAGGG + Intergenic
1113243346 13:108365108-108365130 TTCAAACTTCTGTTGTTCAAGGG - Intergenic
1116665143 14:47765008-47765030 TTCAAACTTGTGTTGTTCAATGG + Intergenic
1116740945 14:48753642-48753664 TTCAAACTGATGTTTGTACAAGG + Intergenic
1118530422 14:66698917-66698939 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1118940962 14:70337240-70337262 TTTAAAGCCATGTAGGTCCATGG + Intronic
1120064096 14:80019516-80019538 TTGAAACTTATGTTGTTCAAGGG + Intergenic
1120147397 14:80993891-80993913 TTCAAACTTGTGTTGCTCAAGGG - Intronic
1121877451 14:97466428-97466450 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1126560945 15:50043364-50043386 TTCAAATTTATGTTGTTCAAGGG - Intronic
1126933096 15:53676611-53676633 TTCAAACTAATTCAGGTCCTTGG - Intronic
1127079976 15:55368049-55368071 TTCAAACTCATGTTGCTCAAGGG - Intronic
1127230116 15:56982037-56982059 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1130216101 15:81971306-81971328 TTCAAACGTTTGTGGGTCCCAGG + Intergenic
1131579798 15:93631817-93631839 TTCAAACTCATGTGGTTCAACGG + Intergenic
1139167926 16:64592170-64592192 TTCAAAGGTATGTACTTCCAGGG + Intergenic
1140004164 16:71058754-71058776 TTCAAACTCATGTTGTTCAAGGG - Intronic
1140553175 16:75890107-75890129 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1140995975 16:80259794-80259816 TTCAAACTTTTGGAATTCCAGGG - Intergenic
1141310471 16:82908825-82908847 TTCAAACCCATGTAGTTCAAGGG - Intronic
1141612452 16:85190080-85190102 TTCCAAGTTATCTAGGTCTAAGG + Intergenic
1146541260 17:33697431-33697453 TTCAAACTCATGTTGTTCAAGGG + Intronic
1149250074 17:54758001-54758023 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1154984682 18:21537866-21537888 TTCAAACTTTTGTTGTTCGAGGG - Intronic
1159457638 18:68681419-68681441 TTCAAACTTATGTTGTTCAACGG + Intronic
1164559477 19:29279364-29279386 TTAAAACTTTTGTAGATTCACGG + Intergenic
1164823420 19:31267122-31267144 TCCAAACTTATGAAAGGCCAAGG + Intergenic
1168569187 19:57450832-57450854 TTCAATTTTATGTACTTCCAAGG + Intronic
925495457 2:4443840-4443862 TTCAAACTCATGTTGTTCAAGGG + Intergenic
928011648 2:27613732-27613754 TTCAAACTCATGTTGTTCAAGGG + Intronic
928338970 2:30424947-30424969 TTCAAAATAATGTATGTTCAAGG - Intergenic
930062293 2:47300223-47300245 TTCAAACTTATAAACATCCATGG - Intergenic
930945693 2:57072233-57072255 TTCAAACCTATGTTGTTCAAGGG - Intergenic
931168678 2:59778962-59778984 GTGGAACTTATTTAGGTCCAAGG - Intergenic
932929281 2:76014517-76014539 TTCAAACATATGTAGGATCATGG - Intergenic
932996233 2:76857059-76857081 TTCAAACCTATGTTGTTCAAGGG - Intronic
934060708 2:88290018-88290040 TTTACACTTATGTAGGTCTGTGG - Intergenic
935714251 2:105926094-105926116 TTCAAACTCGTGTAGTTCAAGGG + Intergenic
937151306 2:119687953-119687975 TTCAAACCTATGTATTTCCTAGG + Intergenic
939661247 2:144892981-144893003 TTCAATATCATGTAGGACCATGG + Intergenic
939679577 2:145113965-145113987 TTCAAACTTATCTTTGTTCAGGG - Intergenic
940419991 2:153469828-153469850 TTTAAACTTAGCTAGGTCCAGGG + Intergenic
940477379 2:154180876-154180898 TTCAAACTCATGTTGTTCAAGGG - Intronic
940875978 2:158897554-158897576 TTCAAACCTATGTTGTTCAAGGG - Intergenic
941167531 2:162098756-162098778 TTTAAAATTATGTAGGCTCATGG - Intergenic
942693019 2:178607569-178607591 TCCATACTTTTGTAGGTACAGGG + Exonic
942991120 2:182204392-182204414 TTCAAACTTATGTTGTTCAAGGG - Intronic
945796942 2:214376867-214376889 TTCAAACCTGTGTTGTTCCAGGG - Intronic
945971560 2:216236276-216236298 TTCAAACTCATGTTGTTCAAGGG + Intergenic
946915234 2:224512873-224512895 TTCAAACTTGTGTTGTTCAAGGG - Intronic
946970502 2:225085836-225085858 TTCAAACCTATGTTGTTCAAGGG - Intergenic
1169517835 20:6337109-6337131 TACAAACTTATTTAGATACAGGG + Intergenic
1169781140 20:9311970-9311992 TTCAAATTCATATAGGTACATGG + Intronic
1169894307 20:10486068-10486090 TTCAAACTCATGTTGTTCAAGGG + Intronic
1172596810 20:36155506-36155528 TTCACACTTGGGGAGGTCCAAGG + Intronic
1172679155 20:36698638-36698660 TTCAAACCTGTGTTGGTCAAGGG + Intronic
1174543817 20:51309945-51309967 TTCAAGCTTTTTTAGCTCCATGG + Intergenic
1174687853 20:52472725-52472747 TTCCAACTTATGTAGGAGAAGGG + Intergenic
1174950334 20:55035420-55035442 TTCAACCTTATCTTGGTCAAGGG - Intergenic
1177345534 21:19863715-19863737 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1177375243 21:20262041-20262063 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1177910762 21:27028441-27028463 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1178153346 21:29822000-29822022 TTCAAACTTGTGTTGTTCAAAGG + Intronic
1178261348 21:31102692-31102714 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1181785808 22:25225788-25225810 TTCTGACCTATGTAGGACCATGG - Intronic
949557121 3:5164191-5164213 TTCAAACCTGTGTAGTTCAAGGG + Intronic
950818637 3:15734011-15734033 TTCAAACTTTTGTTATTCCAGGG - Intronic
952229791 3:31418082-31418104 TTCAAACTTGTGTTGCTCAAGGG - Intergenic
953866306 3:46586101-46586123 TTCAAACATATGTTGCTCAAGGG + Intronic
953938248 3:47065981-47066003 TTCAAACTCATGTTGTTCAAGGG - Intronic
955152427 3:56381507-56381529 TTCAAACCCATGTAGTTCAAGGG + Intronic
955504959 3:59622964-59622986 TTCAAACTCATGTTGTTCAAGGG + Intergenic
955752772 3:62199275-62199297 GTCAAACGTGTGTAGGTCCCAGG - Intronic
955959625 3:64326922-64326944 TTCAAACCTGTGTTGTTCCAGGG + Intronic
956147551 3:66206332-66206354 TTCATACTGAGGTAGATCCAGGG + Intronic
956190248 3:66601225-66601247 TTGAAACTTATGTATGTCCTTGG + Intergenic
958180798 3:90057978-90058000 TTCAAATTTAGGCAGGTCTAGGG - Intergenic
959773494 3:110128003-110128025 TTCAAACCTATGTGGTTCAAAGG + Intergenic
962346889 3:134625077-134625099 CTCAAACTGCTGCAGGTCCAGGG + Exonic
963190016 3:142459595-142459617 TTCAAACTCATGTTGTTCAAGGG - Intronic
963810269 3:149769907-149769929 TTCAAACTCATGTTGTTCAAAGG - Intronic
963982240 3:151551533-151551555 TTCAAACTCATGTTGTTCAAGGG + Intergenic
964740794 3:159963717-159963739 TTCAAACTGATGTTGTTCAAGGG + Intergenic
965523723 3:169695236-169695258 TTCCAAAATATGTAGGTCAAAGG + Intergenic
966760525 3:183413976-183413998 TTCAAACCTATGTTGTTCAAGGG + Intronic
969886680 4:10221339-10221361 GTCATACAGATGTAGGTCCAAGG - Intergenic
970422358 4:15917030-15917052 TTCAAACCTGTGTAGTTCAAGGG - Intergenic
970490510 4:16568800-16568822 TTCAAACTGATGTTGTTCAAGGG + Intronic
971983819 4:33793308-33793330 TTCAAATTTATGTTGTTCAAGGG - Intergenic
972166866 4:36297228-36297250 TTCAAACCTATGTTGTTCAAGGG + Intronic
972216458 4:36903175-36903197 ATGAAAATTATGTAGGTACATGG + Intergenic
977260353 4:94789821-94789843 TTTAAACTCATGTTGTTCCAGGG - Intronic
977550362 4:98435625-98435647 TTCAAACTTACGTTGTTCAAGGG + Intronic
977937285 4:102821546-102821568 TTCAAAATTATGTGTTTCCAGGG + Intronic
979144955 4:117235192-117235214 TTCAAACTCATGTTGTTCAAGGG - Intergenic
979943724 4:126797811-126797833 TTCAAACTCATGTTGTTCAAGGG + Intergenic
980445240 4:132897503-132897525 TTCAAACTTGTGTCGTTCAAGGG - Intergenic
981472848 4:145156840-145156862 TTCAAACCTATGTTGTTCAAGGG - Intronic
981942156 4:150293720-150293742 TTCAAACCTATGTTGTTCAAGGG - Intronic
983344853 4:166515150-166515172 TTCAAACCTATGTTGCTCAAGGG + Intergenic
983393392 4:167162452-167162474 TTTAAACTTAAGTAAGTACATGG - Intronic
984729257 4:183051892-183051914 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
984868133 4:184300464-184300486 TTCAAATTTATGTTGTTCAAGGG + Intergenic
985369778 4:189274069-189274091 TTCAGACTTCTGTAGGTTGAAGG - Intergenic
985991007 5:3561284-3561306 TTCCAACTTATTTAAGTTCAGGG + Intergenic
986473624 5:8100887-8100909 TTCAAACCCATGTAGTTCAAGGG + Intergenic
986728789 5:10619601-10619623 TTCAAACTTAGAAAGGGCCAGGG + Intronic
987752816 5:22064045-22064067 TTCAAACTTGTGTTGCTCAATGG - Intronic
987994642 5:25261058-25261080 TTCAAACTTTTGTTGTTCAAAGG - Intergenic
989462638 5:41718358-41718380 TTCAAACCTATGTTGTTCAAGGG + Intergenic
989714488 5:44445259-44445281 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
990000816 5:50890458-50890480 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
993085712 5:83361302-83361324 ATCAGACTTAGGAAGGTCCAAGG - Intergenic
993494842 5:88596450-88596472 TTCAGATTTATGTAGTTTCATGG + Intergenic
994004503 5:94821877-94821899 TTCAAACTTATGTTGTTTGAGGG + Intronic
994478352 5:100299687-100299709 TTCAAACCTATGTTGTTCAAGGG + Intergenic
994538929 5:101069729-101069751 TTCAAAAAGATGTAGGGCCAAGG - Intergenic
994547976 5:101191809-101191831 TTCATACTTATATAGGTTTAGGG - Intergenic
995160698 5:108977500-108977522 TTCAAACCTATGTAGTTCAAGGG + Intronic
997913477 5:137899810-137899832 TTCAAACTCATGTGGTTCAAGGG - Intronic
998072970 5:139213093-139213115 TTCAAACTTGTGTTGTTCAAGGG - Intronic
998344427 5:141449070-141449092 TAAAAACTGATGTAGGTACAGGG - Intronic
999114138 5:149147601-149147623 TTCAAACCTATGTTGTTCAAGGG + Intronic
999244271 5:150144971-150144993 TTCAAACCTGTGTAGTTCAAGGG - Intronic
999328671 5:150658630-150658652 ATCAAACGTATGTAGGTGAAAGG + Intronic
1001345045 5:170887054-170887076 TTCAAACTCATGTTGTTCAAGGG + Intronic
1001360717 5:171083528-171083550 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1002202135 5:177535547-177535569 TTCAAACAGATTTAGGTGCAGGG + Intronic
1006972378 6:38060032-38060054 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1007036129 6:38675458-38675480 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1008810808 6:55496081-55496103 TTCAAACTTGTGTAGTTTAAGGG - Intronic
1009890774 6:69678465-69678487 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1012160831 6:95884052-95884074 TTCAAACTTATGTTGTTTAAGGG - Intergenic
1012266072 6:97144434-97144456 TTCAAACTTGTGTTGCTCAAGGG + Exonic
1014822594 6:126008544-126008566 TTCAAACTTGTGTTCTTCCAGGG - Intronic
1015262236 6:131251457-131251479 TTCTAATTTAAATAGGTCCATGG + Intronic
1015313333 6:131789405-131789427 TTCAAAATTATCTAGGTCTGTGG + Intergenic
1015646939 6:135402505-135402527 TTCAAACTCATGTTGTTCAAGGG - Intronic
1019402501 7:864055-864077 TTCAAACTTATGTATTTTAATGG + Intronic
1020590072 7:10124404-10124426 TTCAAACCTATGTTGTTCAAGGG + Intergenic
1020713378 7:11636954-11636976 TTATAATTTTTGTAGGTCCATGG - Exonic
1021046057 7:15924646-15924668 TTCAAACTCATTTAGGGCCATGG - Intergenic
1022369982 7:29761415-29761437 TTCAAACTTAAGGAGGACTAGGG - Intergenic
1023202159 7:37710385-37710407 TTCAAAATTATGTAGCTGCAGGG - Intronic
1023886514 7:44360903-44360925 TTCAGACTTTGGAAGGTCCAAGG - Intergenic
1026814280 7:73497746-73497768 TTCAAACCTATGTTGTTCAAGGG + Intronic
1028241460 7:88426064-88426086 TTCAAACTCATGTGAGTACAGGG + Intergenic
1028606513 7:92661821-92661843 TTCAAACCTATGTTGTTCAAGGG + Intronic
1028996959 7:97111344-97111366 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1029108780 7:98200378-98200400 TTCAAACCCATGTTGCTCCAGGG - Intronic
1029913891 7:104186162-104186184 TTCAAACCTATGTCGTTCAAGGG - Intronic
1030002950 7:105085173-105085195 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1030402819 7:109074110-109074132 TTCAAACTCATGTTGCTTCAAGG + Intergenic
1030791020 7:113729246-113729268 TTCAAACCCATGTCGTTCCAGGG - Intergenic
1031200479 7:118677928-118677950 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1032305426 7:130729620-130729642 TTCAAACTCATGTTGCTCAAGGG + Intergenic
1032619012 7:133508600-133508622 TTCAAATTGCTCTAGGTCCAAGG - Intronic
1039733834 8:40308422-40308444 TTAAAACTTGTGTTGTTCCAAGG - Intergenic
1040433909 8:47371019-47371041 TTCTACCTTGTGTAGGTCCTTGG - Intronic
1041407750 8:57518908-57518930 TTCAAACTCATGTTGTTCAAGGG + Intergenic
1042960185 8:74295026-74295048 TTCAAACTTATGTAGGTCCAGGG - Intronic
1044912684 8:97077790-97077812 TTCAAACTCATGTTGTTCAAAGG + Intronic
1045218899 8:100177720-100177742 TTCAAACTTATATTGTTCAAGGG + Intronic
1046765599 8:118066100-118066122 TTCAAACCTATGTTGTTCAAGGG - Intronic
1047842933 8:128773787-128773809 TTCAAACTTCTGTTGTTCAAAGG + Intergenic
1047904862 8:129462127-129462149 TTCAAACCTGTGTTGTTCCAGGG + Intergenic
1048220753 8:132539341-132539363 TTCAAAATAATGTAGGTGTATGG + Intergenic
1049049984 8:140187111-140187133 GTCAAACCTATGTAGTTCGAGGG - Intronic
1050609188 9:7333579-7333601 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1052473395 9:28928430-28928452 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1052968087 9:34357077-34357099 TTCAAACCCATGTTGGTCAAGGG + Intergenic
1052988970 9:34507612-34507634 TTCAAAGTCATGTTGGTCAAGGG + Intronic
1053004256 9:34593685-34593707 TTCTAAATTATTCAGGTCCAAGG + Intergenic
1053226604 9:36363826-36363848 TTCAAACTCATGTTGTTCAAGGG - Intronic
1055552406 9:77444055-77444077 TTCACACTCATGTAGCTACAGGG - Intronic
1058844237 9:108940072-108940094 TTCAAACCTATGTTGCTCAAGGG - Exonic
1059215140 9:112554582-112554604 TTAAAAATTATGTAGAACCATGG + Intronic
1061645376 9:131996665-131996687 TTCAAACTCATGTTGTTCAAGGG - Intronic
1185961564 X:4550563-4550585 TTTAAACTCATGTTGTTCCAGGG - Intergenic
1186304426 X:8240188-8240210 TTCAAACTTGTGTTGTTCAAGGG + Intergenic
1186538187 X:10371600-10371622 TTCAAACCTATGTTGTTCCGGGG - Intergenic
1186703947 X:12122383-12122405 TTCATCCTTCTGTAGGTCCTTGG + Intergenic
1187441346 X:19323496-19323518 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1188902068 X:35746047-35746069 TTCAAACCTATGTTGTTCAAAGG - Intergenic
1191934214 X:66408939-66408961 TTCAAATTTCTGAAGGCCCATGG - Intergenic
1192624099 X:72710192-72710214 TTCAAACTTATGTTGTTCAGGGG - Intronic
1192740123 X:73883947-73883969 TTCAAAATTATGCAAGTACATGG + Intergenic
1194016174 X:88624503-88624525 TTCAAATTTATTTAGGGCCCAGG - Intergenic
1196387424 X:115173708-115173730 TTCAAACTTGTGTTGTTCAAGGG - Intronic
1196430094 X:115615321-115615343 TTCAAACTTCTGCAGGAACATGG + Intronic
1196908297 X:120460379-120460401 TTCAAACTTGTGTTGTTCAAGGG + Intronic
1196964164 X:121037670-121037692 TTCAAACTTGTGTTGTTCAAGGG - Intergenic
1197024758 X:121735741-121735763 TTTTAACTTGTGTAGGTACATGG + Intergenic
1197441511 X:126496317-126496339 TTCAAACTCATGTTGTTCAAGGG - Intergenic
1197638398 X:128941948-128941970 TTCTAGCTTGTGGAGGTCCAAGG + Intergenic
1198816641 X:140598569-140598591 TTCAAACCCATGTAGTTCAATGG - Intergenic
1199605004 X:149570286-149570308 TTCAGACCTGTGTGGGTCCAGGG - Intergenic
1200054485 X:153452036-153452058 TTCAAAATTCTGTTGGTCCCTGG - Intronic
1201890800 Y:18941844-18941866 TTCAAACTCATGTTGTTCAAAGG - Intergenic