ID: 1042960941

View in Genome Browser
Species Human (GRCh38)
Location 8:74303176-74303198
Sequence TACGGGACATGCAGAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042960941_1042960946 -4 Left 1042960941 8:74303176-74303198 CCTCTTTCTCTGCATGTCCCGTA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1042960946 8:74303195-74303217 CGTAAGTCTTTCCCAGGGTTTGG No data
1042960941_1042960943 -9 Left 1042960941 8:74303176-74303198 CCTCTTTCTCTGCATGTCCCGTA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1042960943 8:74303190-74303212 TGTCCCGTAAGTCTTTCCCAGGG No data
1042960941_1042960942 -10 Left 1042960941 8:74303176-74303198 CCTCTTTCTCTGCATGTCCCGTA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1042960942 8:74303189-74303211 ATGTCCCGTAAGTCTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042960941 Original CRISPR TACGGGACATGCAGAGAAAG AGG (reversed) Intronic
900503182 1:3016569-3016591 TAGGGGAGAGGAAGAGAAAGAGG + Intergenic
900670567 1:3851253-3851275 TCCGGGAAATGCAGGGACAGGGG + Intronic
902949813 1:19873570-19873592 CACTGGAAATGCAGAGGAAGAGG + Intergenic
903449380 1:23442528-23442550 CCCAGGACATGCAGAGAGAGCGG - Exonic
904322831 1:29707955-29707977 CACGGCACTGGCAGAGAAAGGGG - Intergenic
904705975 1:32391054-32391076 TAGGGGGCAAGCAGAGGAAGAGG + Intronic
906331455 1:44888414-44888436 AACGGGACATGCCGGCAAAGGGG + Intronic
906513277 1:46423645-46423667 CCCGGGCCATGCAGAGGAAGAGG - Intergenic
910785628 1:90995047-90995069 TACATGATATGCAAAGAAAGAGG + Intronic
912507699 1:110167392-110167414 TACAGGACATGATAAGAAAGTGG + Intronic
912630125 1:111239517-111239539 TGAGGGACATGCAGAGGAAGGGG + Intronic
915078772 1:153336920-153336942 TAAGGAACATGCAAAGTAAGGGG - Intronic
916121319 1:161530802-161530824 TACGGGACATGAAGAGAGCGGGG + Intergenic
918249256 1:182686850-182686872 TACAGGAGGAGCAGAGAAAGAGG + Intergenic
919545984 1:198919296-198919318 TAATGGACAAGCAAAGAAAGTGG + Intergenic
919678584 1:200410353-200410375 CGTGGGAGATGCAGAGAAAGGGG + Intergenic
920308336 1:205032947-205032969 TTAGGGAAATGCAGGGAAAGTGG + Intergenic
921968016 1:221113993-221114015 TACCAGGCATGCAGAGAAATGGG - Intergenic
923166844 1:231372864-231372886 TTTGGGGGATGCAGAGAAAGAGG + Intronic
1062907803 10:1190692-1190714 TATGGCACATGCAGAGAAGCCGG - Intronic
1063253432 10:4299851-4299873 TACTGGCCATGCAAAGAAGGAGG - Intergenic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1063875437 10:10472605-10472627 TACTAGACATGCAGAGAAACAGG - Intergenic
1065298575 10:24300502-24300524 TGCAGGAAATGCAGAGAGAGGGG - Intronic
1066676630 10:37894198-37894220 AATGGGACATGCAGAGAATGAGG - Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1070477525 10:76844795-76844817 TATGAGACATGCAAAGGAAGGGG + Intergenic
1070538684 10:77400296-77400318 TTGGGGCCATGCAGAGCAAGTGG - Intronic
1072319281 10:94233059-94233081 TTCAGCCCATGCAGAGAAAGTGG - Intronic
1072833812 10:98689636-98689658 TACCAGACATGCAAAGAAACAGG - Intronic
1073097465 10:100988537-100988559 GGCTGGTCATGCAGAGAAAGTGG - Exonic
1073795796 10:106987000-106987022 TACTAGTCATACAGAGAAAGTGG - Intronic
1074269434 10:111938760-111938782 TACTAGACATGCAGAGAAACAGG - Intergenic
1075793510 10:125102842-125102864 TACAGGACTTGCAGAGCCAGTGG + Intronic
1076228421 10:128799759-128799781 AAAGGGACATGGAGAGGAAGTGG + Intergenic
1078263666 11:9736407-9736429 TATGAGACATGCAAAGAAAAAGG - Intronic
1079698682 11:23517347-23517369 TATGTGACATGCAAAAAAAGAGG - Intergenic
1080561530 11:33467653-33467675 TACTGCCCAGGCAGAGAAAGCGG - Intergenic
1086214061 11:84356084-84356106 TATGGGACATGAAAAGAAAAGGG + Intronic
1086960168 11:92973136-92973158 TCCGGGAGATGAAGAGAAAAAGG - Intronic
1087746478 11:101953526-101953548 TAAAGGACAGGCAAAGAAAGAGG + Intronic
1089751127 11:120651950-120651972 TCTGGGACATGCAGGGAAGGTGG + Intronic
1089939945 11:122405655-122405677 TATGAGACATGCAGAGTATGAGG - Intergenic
1090060949 11:123463761-123463783 GAAGGGAAATGAAGAGAAAGTGG + Intergenic
1091213900 11:133887833-133887855 TAAGGGGCAGGCAGAGAAAAGGG - Intergenic
1092037585 12:5350941-5350963 TATGAGACATGCAAAGAAATAGG + Intergenic
1092196452 12:6552396-6552418 TACGGGACACACAGGGAAGGGGG - Intronic
1096745312 12:53723258-53723280 CAGGGAACATTCAGAGAAAGGGG - Intronic
1096838811 12:54369047-54369069 TATGGGACCGGCACAGAAAGAGG - Intergenic
1097527498 12:60755957-60755979 TACTAGACATGCAAAGAAGGAGG - Intergenic
1099213599 12:79825106-79825128 TACAGGTCATTAAGAGAAAGTGG + Intronic
1101476609 12:105055517-105055539 TACAAGACGTGCAGAGAAACAGG + Intronic
1101950694 12:109172423-109172445 TACAGGACAGGAGGAGAAAGAGG - Intronic
1106214820 13:27686705-27686727 TATGAGACATGCAAAGAAACAGG + Intergenic
1106646529 13:31639941-31639963 TATGAGACATGCAAAGAAACAGG + Intergenic
1106823067 13:33488099-33488121 TAAGGGAGAGGCAGAGGAAGAGG - Intergenic
1110255639 13:73430937-73430959 TAAAGGACATGCAGAGATGGAGG + Intergenic
1113256136 13:108508205-108508227 TACAAGGCATACAGAGAAAGAGG - Intergenic
1114050137 14:18915062-18915084 CAGGGGACCTGCAGAGAGAGGGG + Intergenic
1114112421 14:19486869-19486891 CAGGGGACCTGCAGAGAGAGGGG - Intergenic
1114335587 14:21686081-21686103 TAGAGGTCATGAAGAGAAAGAGG - Intergenic
1115086023 14:29515767-29515789 TAATGAAGATGCAGAGAAAGGGG - Intergenic
1115989944 14:39141260-39141282 TGCGAGACATGGAGTGAAAGGGG - Intergenic
1116723793 14:48534587-48534609 TACGTTACATGATGAGAAAGGGG - Intergenic
1117802324 14:59457871-59457893 TATGAGACATGCACAGAAATAGG - Intronic
1118085095 14:62405325-62405347 TTCCGGACCTGAAGAGAAAGAGG + Intergenic
1118294595 14:64557681-64557703 TAGGAGACAGGCAAAGAAAGAGG + Intronic
1119901364 14:78262659-78262681 CTCGGTACATGAAGAGAAAGGGG + Intronic
1121069214 14:91001130-91001152 GACAGGACATGCTGAGAAGGTGG - Exonic
1121410647 14:93746230-93746252 TAAGGGAGATGCAGAGGAGGTGG + Intronic
1121865059 14:97355182-97355204 TAAGGGGCATACAGAGAATGAGG - Intergenic
1124442054 15:29692948-29692970 TATGAGACATGCAAAGAAACAGG + Intergenic
1125803437 15:42471280-42471302 TACTGGAAATGCAGAGAACTGGG - Intronic
1126067382 15:44836649-44836671 TATGGGACAGGCAGAGGATGTGG - Intergenic
1126092495 15:45064232-45064254 TATGGGACAGGCAGAGGATGTGG + Intronic
1126367901 15:47914916-47914938 TAAGGGAAGGGCAGAGAAAGAGG + Intergenic
1126801541 15:52302621-52302643 TACAAGACATGCAAAGAAACAGG - Intergenic
1128877589 15:71215020-71215042 TGCGGGACCTGCGGAGACAGAGG - Exonic
1129665624 15:77577979-77578001 TGGGGGACAGGCAGAGATAGAGG + Intergenic
1131117854 15:89805529-89805551 TACCAGGCATGCAGGGAAAGGGG + Intronic
1132066955 15:98739262-98739284 AACAGAGCATGCAGAGAAAGAGG - Intronic
1137260167 16:46820077-46820099 TTCGTAACATGCAGAGAAATAGG - Intronic
1138039203 16:53643826-53643848 TATGAGACATGCAAAGAAATAGG + Intronic
1139665583 16:68453241-68453263 TAGGGGGCAAGTAGAGAAAGAGG + Intergenic
1139892484 16:70262530-70262552 CAAGGGAAATGCATAGAAAGGGG + Intronic
1141767466 16:86068000-86068022 TGCAGGTCAGGCAGAGAAAGAGG + Intergenic
1143187271 17:5017937-5017959 TACGTGTTATGCAGGGAAAGTGG - Intronic
1144050010 17:11490378-11490400 GAAGGGACATGGAGACAAAGGGG + Intronic
1144217066 17:13065667-13065689 TGTGGGAAATGCAGGGAAAGTGG + Intergenic
1145798092 17:27667433-27667455 TACGGGACATGCTGTGCAGGAGG - Intergenic
1147001659 17:37367689-37367711 AAAGGAACATGGAGAGAAAGGGG - Intronic
1148643860 17:49207822-49207844 TGCTGGACCTGGAGAGAAAGAGG - Intronic
1149925660 17:60699728-60699750 TACGGGAGATGGAGGTAAAGAGG + Intronic
1150601597 17:66655534-66655556 TAAAGGGCATGGAGAGAAAGTGG - Intronic
1153354133 18:4117326-4117348 TACAAGACATGCAAAGAAATAGG - Intronic
1157514117 18:48298764-48298786 TAGGTTACAAGCAGAGAAAGGGG - Intronic
1157962332 18:52168829-52168851 TATGGGACAAGCAGAGAGGGTGG - Intergenic
1158759613 18:60369077-60369099 TAGAGCAGATGCAGAGAAAGTGG - Intergenic
1159514600 18:69441998-69442020 CCCGGAACATGCAGAGATAGAGG + Intronic
1160596938 18:79982362-79982384 TAAGGGACATCCAGAGAAAAAGG + Intronic
1167130566 19:47582413-47582435 TAGGAGACAGGAAGAGAAAGAGG - Intergenic
925078587 2:1041004-1041026 TCCGGGACTGGCAGAGAAAAGGG + Intronic
926736722 2:16079026-16079048 CAGAGGACATGCAGGGAAAGGGG - Intergenic
927832508 2:26364323-26364345 TGCATGACATACAGAGAAAGTGG - Exonic
928556211 2:32427781-32427803 TACAAGACATGCAAAGAAAGAGG - Intronic
928749967 2:34459461-34459483 TATGAGACATGAAGTGAAAGGGG + Intergenic
928896262 2:36267146-36267168 TATGAGACATGCAAAGAAACAGG + Intergenic
929687348 2:44046222-44046244 TGCTGGACATGCCGACAAAGGGG - Intergenic
932168589 2:69532331-69532353 CACAGGAGATGCAGAGTAAGAGG + Intronic
935075363 2:99737797-99737819 TAAGAGACATGGAGATAAAGTGG - Intronic
935577883 2:104729643-104729665 TGAGGGAGATGCAGTGAAAGTGG - Intergenic
935612244 2:105037820-105037842 TTCAGGACGTGAAGAGAAAGAGG + Intergenic
937529012 2:122806377-122806399 TTCAGCACATGCAGAGAATGGGG - Intergenic
938889413 2:135688309-135688331 TACAGTACATCCAGAAAAAGAGG + Intronic
941999514 2:171632118-171632140 AACTGGACATGAAGGGAAAGGGG - Intergenic
943567850 2:189537708-189537730 TACTTGAGATACAGAGAAAGGGG - Intergenic
945477151 2:210297299-210297321 TGTGGAAGATGCAGAGAAAGGGG - Intronic
946201648 2:218073996-218074018 TACAGGACAGACAGAGCAAGAGG + Intronic
948799845 2:240427610-240427632 TGCTGGAGGTGCAGAGAAAGAGG - Intergenic
1169759863 20:9079483-9079505 TAGGGGACAGGCAGAGAGTGAGG - Intronic
1170017671 20:11799980-11800002 TATGAGACATGCAAAGAAAGAGG + Intergenic
1171064907 20:22005605-22005627 TTAGGGACATGCAGAAAAAATGG + Intergenic
1171478507 20:25433616-25433638 TACGGAACCTACAGAGACAGAGG + Intronic
1176237031 20:64058177-64058199 GACGGGACAGGCAGGGAAGGGGG - Intronic
1177674808 21:24283049-24283071 TAAGGGCCATGAAGAAAAAGAGG - Intergenic
1179046213 21:37847694-37847716 TACAGGACATCGATAGAAAGAGG + Intronic
1179622279 21:42625125-42625147 CAGGGGACAGCCAGAGAAAGAGG + Intergenic
1180018826 21:45106411-45106433 TACGTGACCTGGAGAGAGAGGGG + Intronic
1180468617 22:15637437-15637459 CAGGGGACCTGCAGAGAGAGGGG + Intergenic
1182809209 22:33102027-33102049 AATGGGAAATGGAGAGAAAGAGG - Intergenic
1183787508 22:40038707-40038729 TTGGGGACAGGCAGAGGAAGAGG + Exonic
1184813919 22:46856063-46856085 CAGGGGACATGCAGAGGAAAGGG - Intronic
949329089 3:2901436-2901458 TACATGACAGGAAGAGAAAGGGG + Intronic
951326935 3:21313718-21313740 TTCTGGACATGCTGAGACAGGGG - Intergenic
952521811 3:34168287-34168309 TATGAGACATGCAAAGAAACAGG - Intergenic
953267063 3:41400814-41400836 TAGGGGAGATGCTGAGAAATTGG - Intronic
953484299 3:43280434-43280456 TACGAGACATGGAAAGAAACAGG + Intergenic
955150057 3:56358013-56358035 TACCGGCTAAGCAGAGAAAGGGG + Intronic
955207372 3:56908444-56908466 AAGGGGAGATCCAGAGAAAGAGG + Intronic
955989329 3:64609302-64609324 TAAAAGACATGCAAAGAAAGCGG + Intronic
956852119 3:73238651-73238673 TATGAGACATGCAAAGAAACAGG + Intergenic
957622734 3:82615541-82615563 TCAAGGACATGCAGAGAATGGGG + Intergenic
957911779 3:86627215-86627237 TACTAGACATGCAAAGAAACAGG + Intergenic
958131040 3:89423333-89423355 TACCGTACATGCAGGGAAACAGG - Intronic
962309950 3:134318651-134318673 TGGTGGACCTGCAGAGAAAGGGG + Intergenic
962872576 3:139510672-139510694 TACAGAAAATGCAGAGATAGAGG - Intergenic
963218080 3:142773624-142773646 TAAGGGACATGCAAAGAAATGGG - Intronic
965579345 3:170250493-170250515 TCTGGGGCCTGCAGAGAAAGGGG - Intronic
966505332 3:180694385-180694407 TAGGGGAGAGACAGAGAAAGAGG + Intronic
966771587 3:183508973-183508995 TACAGGAAATACAGGGAAAGAGG + Intronic
968890765 4:3367326-3367348 GACGGGGCGTGAAGAGAAAGTGG - Intronic
974000410 4:56506075-56506097 TAAGGGACAAGAAGAGAAAGGGG + Intronic
974235400 4:59174287-59174309 TACAGAACATGCAGTGTAAGGGG - Intergenic
977915578 4:102588607-102588629 TAAGGCACATGCACAGAAATAGG + Intronic
978610046 4:110527330-110527352 TAAGTGACATTCAGAGAAACTGG + Intronic
992079609 5:73222788-73222810 TACAGGGCAAGAAGAGAAAGAGG - Intergenic
992166400 5:74056157-74056179 TACCAGAGATGCTGAGAAAGGGG - Intergenic
997535100 5:134614368-134614390 TACTAGACATGCAAAGAAACAGG - Intronic
1001623998 5:173114994-173115016 TACGGGGCAGGGAGAGAAAAGGG - Intronic
1002116805 5:176968677-176968699 TATGGGAGATGAAGACAAAGAGG - Exonic
1003864785 6:10353039-10353061 TATGGGACTTGCAGAGGAAAGGG + Intergenic
1004489292 6:16099050-16099072 TTAGGGAAATGCAGAGAAAGTGG - Intergenic
1006242901 6:32701727-32701749 TACAAGACATGCAAAGAAACTGG - Intergenic
1006645740 6:35512878-35512900 TCCTAGACCTGCAGAGAAAGGGG - Exonic
1007286029 6:40748140-40748162 GAAGGGACATGCACAGACAGAGG - Intergenic
1007459662 6:42008975-42008997 TAGGGAACATGCAGACAGAGAGG + Intronic
1007581466 6:42962738-42962760 TAGGGGTCAGGAAGAGAAAGAGG - Intronic
1007636752 6:43304223-43304245 TCCAGGACGTGGAGAGAAAGAGG + Exonic
1008738981 6:54581962-54581984 TACTGGACATGCAAAGAACCAGG - Intergenic
1011003070 6:82613334-82613356 TACCAGAAATTCAGAGAAAGTGG + Intergenic
1011442360 6:87400152-87400174 AAGGGGACATTCAGAGATAGAGG + Intergenic
1013240605 6:108241789-108241811 TATGAGACATGCAAAGAAACTGG + Intronic
1013385548 6:109626348-109626370 TACAAGACATGCAAAGAAACAGG - Intronic
1014270415 6:119330051-119330073 TACAGGATGTGCAGAGTAAGTGG - Intronic
1014818422 6:125959302-125959324 TAAGGGACAGACAGAGGAAGAGG + Intronic
1015439033 6:133225938-133225960 TTCCGGATATGCAGAAAAAGGGG - Intergenic
1015641602 6:135339282-135339304 TACGAAACATGCAAGGAAAGAGG + Intronic
1019025615 6:168960506-168960528 AAAGGGACAGGGAGAGAAAGTGG + Intergenic
1019723147 7:2585814-2585836 TACGGGACCTGCAGATAATGAGG + Intronic
1020064690 7:5178353-5178375 TATGAGACATGCAAAGAAATAGG + Intergenic
1020213554 7:6172222-6172244 TGAGGGACGTGCAGAGGAAGAGG - Intronic
1022355651 7:29612123-29612145 AAGGGGAAATGCAGAGAAAAAGG + Intergenic
1022374241 7:29798779-29798801 TACTGAACAGGCAGAGAAAGAGG - Intergenic
1022698597 7:32735114-32735136 TAAGAGACAGGCAGAGGAAGAGG + Intergenic
1023325369 7:39049960-39049982 TATGAGACATGCAAAGAAACAGG - Intronic
1023761788 7:43471116-43471138 TTGGGGACATTAAGAGAAAGTGG - Intronic
1024034514 7:45495850-45495872 TTCAGGACATGGTGAGAAAGGGG - Intergenic
1024583998 7:50825152-50825174 TACGGGGCAGGCAGGGAAGGAGG - Intergenic
1027796426 7:82699612-82699634 TAGGAGACATGCAGAGAATCAGG - Intergenic
1028835733 7:95373111-95373133 TAGGGGACATGGAGAGGAAGTGG - Intronic
1030893086 7:115024768-115024790 TAGGGGACAGGGAAAGAAAGAGG + Intergenic
1031090737 7:117350486-117350508 TATGAGACATGCAAAGAAATAGG + Intergenic
1031547819 7:123071241-123071263 TACTAGACATGCAAAGAAACAGG + Intergenic
1032307949 7:130754582-130754604 TACTGCACATGCCCAGAAAGTGG + Intergenic
1032360973 7:131254372-131254394 TACGAGACATTCACAGAAACAGG + Intronic
1033153163 7:138934226-138934248 AACGGAACCTGCAGAGAAAGTGG + Intronic
1033177713 7:139140827-139140849 TCAAGGAAATGCAGAGAAAGTGG + Intronic
1033672661 7:143507930-143507952 TACAGGATAGGCAGAGGAAGGGG - Intergenic
1033684339 7:143624621-143624643 TACTAGACATGGAGATAAAGTGG - Intronic
1033687515 7:143703840-143703862 TACTAGACATGGAGATAAAGTGG - Intronic
1033700272 7:143833002-143833024 TACTAGACATGGAGATAAAGTGG + Intergenic
1034383229 7:150717192-150717214 AAGGGGCCATGCAGGGAAAGGGG - Intronic
1034672415 7:152868696-152868718 AACGCCACATGCAGAGAGAGCGG - Intergenic
1034719430 7:153275853-153275875 TGTGAGACATGCAGAGAAAAAGG + Intergenic
1035019606 7:155792686-155792708 CACGGGCCATGAAGAGAAGGGGG - Intergenic
1036164318 8:6418275-6418297 TAGGGGACAGACAGAAAAAGTGG + Intronic
1039914890 8:41852488-41852510 TGGGGGACATACAGAGGAAGAGG + Intronic
1042960941 8:74303176-74303198 TACGGGACATGCAGAGAAAGAGG - Intronic
1045558322 8:103236572-103236594 TAAGGGACAGGCAGAGGAAGAGG - Intergenic
1047890748 8:129305973-129305995 TATGACACATTCAGAGAAAGAGG - Intergenic
1048878659 8:138856044-138856066 TGGGGGACTTGCAGAAAAAGGGG + Intronic
1049416460 8:142497732-142497754 AAGAGGACATTCAGAGAAAGGGG - Intronic
1049712489 8:144071622-144071644 GATGAGACATGCAAAGAAAGAGG + Intergenic
1055495435 9:76849983-76850005 CAGAGGACATGCAGAGAAAAGGG - Intronic
1057027031 9:91741915-91741937 TACCAGACATGCAAAGAAACAGG + Intronic
1057963986 9:99485515-99485537 TATGGGACATACAAAAAAAGTGG - Intergenic
1189098109 X:38161129-38161151 TACAGGACATGGAGAGACTGAGG + Intronic
1189406823 X:40732844-40732866 TTCAGGACATGCAGTTAAAGAGG + Intronic
1190447237 X:50538479-50538501 TATGAGACATGCAAAGAAACAGG + Intergenic
1192636312 X:72822954-72822976 TACGAGACGTGCAAAGAAACAGG - Intronic
1192645402 X:72897860-72897882 TACGAGACGTGCAAAGAAACAGG + Intronic
1193993332 X:88335747-88335769 TATGAGGCATGCAGAGAAACAGG + Intergenic
1194086888 X:89538937-89538959 TAGGGGACAAGCAGGGAAAAAGG + Intergenic
1194896690 X:99450804-99450826 CATGGGAAATCCAGAGAAAGAGG - Intergenic
1195497747 X:105557207-105557229 TAATAGAAATGCAGAGAAAGAGG - Intronic
1196740100 X:119017201-119017223 TAGGGGAAAGGGAGAGAAAGAGG + Intronic
1196896338 X:120340509-120340531 TATGAGACATGCAAAGAAACAGG - Intergenic
1197104539 X:122698552-122698574 TACGAGACATGCAAGGAAAATGG - Intergenic
1199493762 X:148429787-148429809 TACGGTACATTCATAGAAATTGG + Intergenic
1199735145 X:150679109-150679131 TACGGGACAGACAGAGGAAGAGG + Intergenic
1200439547 Y:3194806-3194828 TAGGGGACAAGCAGGGAAAAAGG + Intergenic
1200585071 Y:4998983-4999005 TACAGGATAAGCACAGAAAGTGG + Intergenic