ID: 1042963019

View in Genome Browser
Species Human (GRCh38)
Location 8:74322309-74322331
Sequence GCTGTTAAGAAGCACAAACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042963019_1042963025 28 Left 1042963019 8:74322309-74322331 CCTCGTTTGTGCTTCTTAACAGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1042963025 8:74322360-74322382 TGCCCAACAGGTAGACGGCTCGG No data
1042963019_1042963024 23 Left 1042963019 8:74322309-74322331 CCTCGTTTGTGCTTCTTAACAGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG No data
1042963019_1042963023 16 Left 1042963019 8:74322309-74322331 CCTCGTTTGTGCTTCTTAACAGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1042963023 8:74322348-74322370 CCTGGAGCTGTGTGCCCAACAGG No data
1042963019_1042963020 -2 Left 1042963019 8:74322309-74322331 CCTCGTTTGTGCTTCTTAACAGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1042963020 8:74322330-74322352 GCCTTAGAGATTCTTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042963019 Original CRISPR GCTGTTAAGAAGCACAAACG AGG (reversed) Intronic
900975053 1:6011657-6011679 GCTGTTGAGAAATAGAAACGGGG + Intronic
901718819 1:11178626-11178648 GATGTGAAGAAGCAGAAAGGGGG - Intronic
902046189 1:13526438-13526460 GGTGTTAAGAAGCCCAGACGAGG + Intergenic
906258534 1:44368688-44368710 GCTGTTCAGCAACACAAAGGAGG + Intergenic
908696819 1:66853174-66853196 GCTGATGAGAAGCACAGAGGAGG + Intronic
910079150 1:83319221-83319243 GCTATAAAGAAGTATAAACGAGG + Intergenic
910310264 1:85815509-85815531 GCTGTTAAGAAGTCCTAACATGG - Intronic
913197319 1:116468388-116468410 GCTGTTAAGATGCACATTCCTGG - Intergenic
916742186 1:167655653-167655675 GCTGATAAGAGGTACAAAAGTGG + Intronic
918909442 1:190546862-190546884 GCAGTTAAAAAGAACAAACATGG + Intergenic
920282557 1:204855006-204855028 GCTGTCAGGAAGCTCAAAGGAGG - Intronic
922822142 1:228492011-228492033 GCTTTTAAGAAGCAGAATGGAGG + Intronic
924180190 1:241433147-241433169 GCTTTTAAGAAACACAAAAATGG - Intergenic
1063806613 10:9652005-9652027 GCTGTTAAAAAGAAGAAAAGAGG + Intergenic
1066089613 10:32004627-32004649 GCTGTTAAGTACCACAGACTGGG + Intergenic
1066327274 10:34374933-34374955 GCTGTTGAGAAGCACCAAGATGG - Exonic
1071047977 10:81407058-81407080 GCTGTTAAGAAATAGAAAAGAGG - Intergenic
1078389317 11:10922662-10922684 GCTGTTATGAAGAATAAAGGAGG - Intergenic
1080000313 11:27340494-27340516 GCTTTTAAGAAATACAAATGTGG + Intronic
1082646162 11:55728912-55728934 GATGTTAAGGAGCACAAAAAAGG + Intergenic
1085383645 11:76142834-76142856 GCTGTTATGCAGGACAAATGTGG - Exonic
1085487937 11:76884385-76884407 GCAGTTAACAAGCATAAAAGAGG - Intronic
1085638919 11:78179035-78179057 GCTGATAAGAACCTCAAATGGGG + Intronic
1085973215 11:81619742-81619764 GCTGTTTTGAAGCACAAATAAGG - Intergenic
1092754968 12:11754744-11754766 GCTGGTAAGCAGCACAGACACGG - Intronic
1097290435 12:57909939-57909961 GCTGCTAAGAAGAAAAAAAGAGG + Intergenic
1101040524 12:100750991-100751013 GCTGTGATGATGCACAAACATGG + Intronic
1102574192 12:113845430-113845452 GCTGTTAAAAAGCAGAAAGAGGG - Intronic
1103911834 12:124356216-124356238 GCTGTAAAGCAGCACAGCCGGGG - Intronic
1106278061 13:28234113-28234135 GCAGTTAAGAAGCACTAGTGTGG + Intronic
1108185206 13:47881789-47881811 GCTTTTAAGAAACAGAAAAGAGG + Intergenic
1110522624 13:76498704-76498726 GTTGTAAAGATGCACAAAAGGGG - Intergenic
1116044364 14:39725796-39725818 GCTGTTAAGGAACATCAACGTGG - Intergenic
1118987470 14:70769159-70769181 GCTGTTCACAGGCACAAACATGG - Intronic
1121116816 14:91349457-91349479 GCTGTTCAGAGGGAGAAACGGGG + Intronic
1121805846 14:96821778-96821800 GATGTAAAGAAGCACAGAGGTGG - Intronic
1122645223 14:103189437-103189459 GCTGTTAAGAAGGACAGTCCCGG + Intergenic
1124254832 15:28131975-28131997 GCTCCTAAGGAGCACACACGGGG + Intronic
1126063736 15:44809184-44809206 GCTGTTAAGATGCTCAAGCCAGG - Intergenic
1126761929 15:51977416-51977438 GCTGTGAAAAAGCCCAAAGGAGG + Intronic
1127194675 15:56570784-56570806 GCAGTTAAAAAGGACAAAGGGGG + Intergenic
1128467986 15:67928755-67928777 GCTGATAAGATGCTGAAACGTGG - Intergenic
1132273490 15:100546069-100546091 GCTATTAAAAAGCACTAACAAGG - Intergenic
1135643925 16:24144986-24145008 GCTGTCAAGAAAAACAAAGGAGG + Intronic
1137021415 16:35432096-35432118 GGTGTTCAGAAGCATAAAGGAGG - Intergenic
1139412468 16:66775128-66775150 GCAGTTGTGAAGCACAAATGTGG + Exonic
1142074294 16:88108494-88108516 GCTGTCAAGTTGCACAAACCTGG + Intronic
1144013969 17:11176261-11176283 GCTGTTAACATGAACAAAGGTGG + Intergenic
1146920164 17:36704727-36704749 GGTGTTAAGAGGCCCAAACCAGG - Intergenic
1149724559 17:58880246-58880268 GCTTTTAAGAAACAGAAAAGAGG + Intronic
1150734419 17:67724296-67724318 GCTGTAAAGAAGCACAGAAATGG - Intronic
1160280152 18:77482260-77482282 ACTGTGAGGAAGCACACACGAGG + Intergenic
1168048435 19:53810681-53810703 GCTGTTAAGAAGCAGCTCCGTGG + Exonic
925297178 2:2785239-2785261 GCTGCTCAAAAGCACAAACCAGG - Intergenic
926274113 2:11390680-11390702 GCAATTAAGAAGCACAAAAAGGG - Intergenic
933505209 2:83168774-83168796 GCCTTTAAGAAGCACCATCGTGG + Intergenic
935268603 2:101414912-101414934 TCTGTTAAGAACAACACACGTGG + Exonic
939580395 2:143939608-143939630 GCTCTTAAGAAGAAGAAAAGAGG - Exonic
941740702 2:169032124-169032146 GCTGTTGAGAGGCCCAAATGAGG - Intergenic
941783143 2:169470617-169470639 GCTGTGAGGAAGAACATACGGGG + Intergenic
946068518 2:217010958-217010980 GCTGTGAGGAAGCTCAAATGTGG - Intergenic
946284823 2:218695021-218695043 TCTGTTAAGAAGAACAAGTGGGG - Intronic
947291190 2:228576364-228576386 GCTGTCAAGAAGCAAAATCATGG + Intergenic
1171131170 20:22653942-22653964 GCTGTTCACAAGGACAAACAGGG + Intergenic
1171328222 20:24314709-24314731 GCTGTTATGAAGGCTAAACGAGG - Intergenic
1172435238 20:34924346-34924368 GCTGTTAAGAAAAATAAACAGGG + Intronic
1174447493 20:50600455-50600477 GCTGTTAAAAAGTACAAAAAAGG + Intronic
1183756281 22:39769304-39769326 GATTTAAAGAAGCACAAACGAGG + Intronic
1184064862 22:42112606-42112628 TTTGTTTAGAAGCATAAACGAGG + Intergenic
1184064872 22:42112665-42112687 TTTGTTTAGAAGCATAAACGAGG + Intergenic
1184064882 22:42112724-42112746 TTTGTTTAGAAGCATAAACGAGG + Intergenic
1184064902 22:42112842-42112864 TTTGTTTAGAAGCATAAACGAGG + Intergenic
949280073 3:2335541-2335563 CCTGTAAAGCAGCACAAAAGCGG + Intronic
964096944 3:152942788-152942810 GATATTAAAAAGCACAAAAGTGG - Intergenic
965132043 3:164713363-164713385 ACTGTTCAGTAGCACAAAAGAGG + Intergenic
965225882 3:165989344-165989366 ACTGTAAACAAGCACAAACCAGG + Intergenic
966045175 3:175540167-175540189 GCTGTGAAGAAAAACAAAGGAGG + Intronic
966160603 3:176963533-176963555 GCTTTTAAGAAACAAAAAAGAGG + Intergenic
966649960 3:182289381-182289403 ACTATTAAGTAGCAGAAACGTGG + Intergenic
968504346 4:965005-965027 GCTGTTGTGAGGCACAAACAAGG + Intronic
969956932 4:10900231-10900253 GCTGTAAAGAAGCTTAAACTAGG - Intergenic
969979172 4:11136814-11136836 GCTGAGAAGAATCACAAAAGTGG - Intergenic
970265147 4:14274603-14274625 TTTGTTAGGAAGCACAAAAGGGG - Intergenic
974007578 4:56574117-56574139 GTTGTTAAGAAGAACAATGGTGG + Intronic
974637392 4:64582671-64582693 GCTGTTAAGAAGGAGGAAGGGGG + Intergenic
975727149 4:77303244-77303266 GCTGCTAGGAAGCTCAAACTGGG - Intronic
978147950 4:105399134-105399156 GATGTTAAGAAGTTCAAACCGGG - Exonic
978878927 4:113676649-113676671 GCTTTTAAGAAACAGAAAGGAGG - Intronic
979056044 4:115996212-115996234 GGTGTTAAGAGCCACAAATGTGG - Intergenic
979830736 4:125298064-125298086 GCTGTGCAGAAGCACAGAAGCGG + Intergenic
980784676 4:137537004-137537026 GCTGTGAGGCAGCACAAACCAGG + Intergenic
981196393 4:141925825-141925847 GCTGTAAAAAAGTACAAATGTGG - Intergenic
982849745 4:160297437-160297459 GATGCCAAGAAGCACAAATGAGG + Intergenic
984265872 4:177497187-177497209 GCTTTTAAGAAGTAGAAAAGAGG - Intergenic
986104177 5:4644066-4644088 GCTGTTAAGAAACGTAATCGTGG + Intergenic
990659365 5:57995888-57995910 CCTGCTAAGAAGCACAGAGGAGG + Intergenic
992071674 5:73154474-73154496 GCTGTTCAGAGGCAGAAACCAGG - Intergenic
993111371 5:83661396-83661418 CCTGTTAAGAATCACAATGGTGG + Intronic
995823741 5:116269166-116269188 GTTGTTAATAAACATAAACGTGG - Intronic
1000015153 5:157269238-157269260 GCTCTTAAGTAGCACAAGAGAGG + Intronic
1000466544 5:161585522-161585544 ACTGTTAAGAGGCTCAAAGGAGG - Intronic
1002759426 6:190282-190304 GCTGTAAAGAACCACAAACCAGG + Intergenic
1004374063 6:15076516-15076538 GCCATTAAGAAGTAGAAACGTGG - Intergenic
1009400880 6:63254246-63254268 GCTGTTAAGTACCACAAATTTGG + Intergenic
1011401030 6:86961626-86961648 GCTGTTAAGAAGCTCTGACTCGG + Intronic
1017262617 6:152404457-152404479 GCTGTTATGATGTACAAACGTGG + Intronic
1018800929 6:167221799-167221821 GCTGTAAAGAAGCACACAGTGGG + Intergenic
1018809207 6:167285371-167285393 GCTGTAAAGAAGCACACAGTGGG - Intronic
1020645804 7:10812586-10812608 CATGTTAAGAAGAACAAACTTGG - Intergenic
1025523112 7:61766403-61766425 GATGTTAGGTAGCACAAAAGAGG - Intergenic
1025546863 7:62185432-62185454 GATGTTAGGTAGCACAAAAGAGG - Intergenic
1027352294 7:77324453-77324475 GCTGTTTATTGGCACAAACGTGG - Intronic
1031810024 7:126355881-126355903 GCTCTTAAGAAACACAATCTAGG - Intergenic
1035429844 7:158810992-158811014 GCTGTTAAAAAAAACAAAAGGGG + Intronic
1037962361 8:23106982-23107004 GCTTTTAGGAAACACAAAAGAGG + Intronic
1037969079 8:23159325-23159347 GCTTTTAGGAAACACAAAAGAGG - Intronic
1042963019 8:74322309-74322331 GCTGTTAAGAAGCACAAACGAGG - Intronic
1048382649 8:133881032-133881054 GCTGTTAAAAGGCACACACAAGG - Intergenic
1048933945 8:139339963-139339985 GGTGTTGAGAAGCTCAAATGGGG - Intergenic
1050350046 9:4732808-4732830 GCAGTTATGAAGCACAAAAGAGG + Intronic
1052760196 9:32582366-32582388 TCTGTGAAGATGCACAAGCGAGG + Intergenic
1057237186 9:93371046-93371068 GCATGTAAGAAGCACAAAGGAGG - Intergenic
1060195736 9:121622286-121622308 GAGGGTAAGAAACACAAACGGGG - Intronic
1061730447 9:132609918-132609940 ACTGTTAAGAAACACACATGTGG - Intronic
1186054312 X:5632648-5632670 GTTGATAAGAACCTCAAACGGGG - Intergenic
1186991723 X:15076825-15076847 CCTGTTAACAAGCAGAAAGGAGG - Intergenic
1187495506 X:19792075-19792097 GCTGTTAACATGCAAAACCGTGG - Intronic
1190618115 X:52259211-52259233 GCTGTTCAGAAGCAGAAAATAGG - Intergenic
1190693369 X:52931184-52931206 GCTGTTCAGAAGCAGAAAATAGG - Intronic
1193273163 X:79553151-79553173 TCTGTTAAGAGGCACAGACAGGG - Intergenic