ID: 1042963021

View in Genome Browser
Species Human (GRCh38)
Location 8:74322331-74322353
Sequence TCCAGGCTCAAGAATCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042963021_1042963024 1 Left 1042963021 8:74322331-74322353 CCTTAGAGATTCTTGAGCCTGGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG No data
1042963021_1042963023 -6 Left 1042963021 8:74322331-74322353 CCTTAGAGATTCTTGAGCCTGGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1042963023 8:74322348-74322370 CCTGGAGCTGTGTGCCCAACAGG No data
1042963021_1042963025 6 Left 1042963021 8:74322331-74322353 CCTTAGAGATTCTTGAGCCTGGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1042963025 8:74322360-74322382 TGCCCAACAGGTAGACGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042963021 Original CRISPR TCCAGGCTCAAGAATCTCTA AGG (reversed) Intronic
902570855 1:17346270-17346292 TCCCGGCCCAAGGATCTCTCAGG - Intronic
908905888 1:69008134-69008156 TCCAGGTTCAAGCATTTCTCCGG - Intergenic
913199955 1:116487895-116487917 TCCCTGCTCAAGAATGTCCATGG + Intergenic
913213538 1:116601013-116601035 TCCAGGCTGAAGGAGCTCTGAGG - Intronic
916164503 1:161953703-161953725 TCCAAACTCAAGAATCTTTCTGG - Intronic
917344975 1:174021095-174021117 ACAAGGCACAAGAAGCTCTATGG + Intronic
918778467 1:188667421-188667443 TCCAGCCTTAGGAATCCCTAAGG + Intergenic
921091922 1:211851803-211851825 TGCAGGCTGAAGAGTATCTAAGG + Intergenic
921809754 1:219499136-219499158 TCTACTCTCAAGAATCTCTGGGG + Intergenic
923546145 1:234924758-234924780 TCAAGGCTCCAGAAACTCTCTGG + Intergenic
923857296 1:237858799-237858821 TCCAGGCACAAGAATTCCCAGGG + Intergenic
1063875401 10:10471931-10471953 TCCAGGCTCCATAATTTCTTAGG + Intergenic
1073087666 10:100904351-100904373 TCCATGTGCAAGAATTTCTATGG - Intergenic
1074259489 10:111837741-111837763 TCCAGGCACAAGAAACTACATGG - Intergenic
1075100351 10:119502278-119502300 TCCAGGCACAAGAGTCCCCAAGG + Intronic
1075672345 10:124271048-124271070 TCCAGGCTCTGGAACCTCTCTGG - Intergenic
1075850616 10:125583712-125583734 TCCAGACTCAAGATTCTATTTGG - Intronic
1077680008 11:4230714-4230736 TCAAGTTTCAAAAATCTCTAGGG + Intergenic
1077681476 11:4245193-4245215 TCAAGTTTCAAAAATCTCTAGGG - Intergenic
1077689419 11:4327289-4327311 TCAAGTTTCAAAAATCTCTAGGG + Intergenic
1081668517 11:44930472-44930494 TCCAGGCTAAAGAATCCCGAAGG + Exonic
1082617885 11:55383859-55383881 TCCATGCTCAAGAAGCCCTGAGG - Intergenic
1083782715 11:64926339-64926361 TTCAGGGCCAAGGATCTCTACGG - Intronic
1084099121 11:66933851-66933873 TCCTGGCTCAAGCATCTCAGGGG + Intronic
1084697602 11:70764955-70764977 TCCAGGCCTAAGAATCTGTTGGG - Intronic
1085657299 11:78328206-78328228 TCCTGGGTCAATAATCTCAATGG + Intronic
1086341658 11:85853935-85853957 TCCAGGCTCAAGCAATTCTTCGG + Intergenic
1087923960 11:103898352-103898374 TCCCTGCTCAAAACTCTCTAAGG + Intergenic
1088146384 11:106685369-106685391 TCCATACTTAAGAATATCTACGG - Intronic
1089079405 11:115763279-115763301 TCCAGGGTCAAGTTTCTCTCTGG - Intergenic
1089499396 11:118923621-118923643 TCCAGGCACAAGAGTCACTCTGG + Intronic
1092077766 12:5687469-5687491 TCCTTGCTTAAGAAACTCTATGG + Intronic
1092632445 12:10396412-10396434 TCCAGGCTCAAGCAATTCTTCGG - Intronic
1093232374 12:16562721-16562743 TCCAGGCCCAGGAAAATCTATGG + Intronic
1099236913 12:80093160-80093182 TCCAGGCTCATGAAGAACTACGG + Intergenic
1100085630 12:90906860-90906882 CCCAGGATTAATAATCTCTAAGG - Intronic
1100149791 12:91723020-91723042 TCCAGGCTGGAGAACCACTAGGG - Intergenic
1104081929 12:125436685-125436707 TCCAGGCTCCAGAACTTCAAGGG + Intronic
1104626073 12:130355975-130355997 TACAGGCTCCACATTCTCTAGGG - Intronic
1104813674 12:131633708-131633730 TCCAGGCACAAGATTGTCTCAGG + Intergenic
1105216772 13:18291569-18291591 TCCAGGCTGAAGGAACTCTGAGG - Intergenic
1109517736 13:63465940-63465962 TCCAGGTTCATGAATCTCAAAGG + Intergenic
1114659689 14:24336213-24336235 TCCAGGCTTCAGGATCTTTAGGG + Exonic
1115645451 14:35366034-35366056 TCCAGGCTCAAGAATCTCAGTGG - Intergenic
1123705629 15:22949052-22949074 TACAGATTCAAGAAGCTCTATGG + Intronic
1137012447 16:35336259-35336281 TCCAGAATCCAGAATCTGTAAGG + Intergenic
1138112766 16:54337662-54337684 TCCACTCTGAAGAATTTCTAGGG + Intergenic
1140264215 16:73406540-73406562 TCCAGGCTCAACAATTCGTATGG + Intergenic
1143717688 17:8786495-8786517 TCCAGGCCCCAGCATCTCTCGGG + Intergenic
1144421645 17:15104377-15104399 GCCAGGCTCAATAATCTCCCAGG + Intergenic
1146429926 17:32783083-32783105 TACATGCTCAAGTATCTCCAAGG + Intronic
1146902323 17:36596839-36596861 TCCAGGCCCAAGCATCTGTGAGG - Intronic
1153495852 18:5698661-5698683 TCAAGATTCAAGAAGCTCTAAGG - Intergenic
1157736669 18:50055629-50055651 TGCAGGCTCAACAGTCTCTTGGG - Intronic
1163858655 19:19727524-19727546 TCGAGGCTCAGGAATTTTTACGG - Intronic
1165285703 19:34839671-34839693 CCCAGGCTCAAGTCTCTCCAGGG - Intergenic
1166300612 19:41910196-41910218 TCCAGTCTCAGGCATCTTTAGGG + Intronic
1166413493 19:42573933-42573955 TCCAGGCTGAAGTATCCCTTTGG - Intergenic
925807111 2:7661333-7661355 TCCAGGCCCCAAAATCGCTAGGG + Intergenic
927176090 2:20409442-20409464 TCCAGACCCAAGAAGCTCAAAGG - Intergenic
934297555 2:91755109-91755131 TCCAGGCTGAAGGAACTCTGAGG + Intergenic
935440839 2:103094080-103094102 TCCAGGCTCAGGAAAGTCTGTGG - Intergenic
936669468 2:114640155-114640177 CCCTAGCTCAAGAATCTCTGAGG + Intronic
940381569 2:153020512-153020534 TCCAGGCCTAAGTTTCTCTATGG - Intergenic
943041777 2:182812818-182812840 TTAGGGCTCAAGAATCTGTAAGG - Intergenic
943092817 2:183394727-183394749 TCCAGTCTCAAGTATGTCTTTGG - Intergenic
943945835 2:194062561-194062583 TTCTGGCTAAGGAATCTCTACGG + Intergenic
945718047 2:213382686-213382708 TCCAGGCTTCAGAATTTCTTTGG + Intronic
946856531 2:223955796-223955818 TCCAGGCTCAGAAAACTTTAAGG - Intergenic
1168927304 20:1592623-1592645 TTCAGAGTCAAGAATCTCTTAGG - Intronic
1174199566 20:48797886-48797908 TCCAGGCTGAGGAATCTTGAGGG - Intronic
1174363530 20:50042985-50043007 TCCAGGCTCAACCAACTCCATGG + Intergenic
1178008145 21:28247210-28247232 CAAAGGCTCAAAAATCTCTAAGG - Intergenic
1179142697 21:38740987-38741009 TCAAGGCTCAAGGAGCTCCATGG + Intergenic
1179688651 21:43067914-43067936 TCCAGGCTCAAGAACGTGGAGGG - Intronic
1181331296 22:22093887-22093909 ACCAGGGTCAACAATGTCTAGGG + Intergenic
950947760 3:16967641-16967663 TCTAGTATCAAGAATCTATAAGG - Intronic
953398780 3:42593672-42593694 TCTAGACTCTAGAATCTATAAGG + Intronic
955268267 3:57469033-57469055 TCTAGCCTAAAGGATCTCTAAGG - Intronic
955507371 3:59645721-59645743 TCAAGGCTATAGAACCTCTAGGG - Intergenic
960488381 3:118280392-118280414 TCCAGGCCAAAGAATCCCAAGGG - Intergenic
960552199 3:118988336-118988358 TCCAGACTGAATTATCTCTAGGG - Intronic
962888943 3:139654257-139654279 TCCAGGCTCATGGATCAGTAGGG - Intronic
963298454 3:143573382-143573404 TCCATGCAGAAGAATCTCCATGG - Intronic
970450665 4:16164054-16164076 GCCAGGCTCCAGGATCTCTGTGG - Intronic
970688450 4:18594587-18594609 TACAGACTTAAGAATCTTTATGG + Intergenic
971304981 4:25472170-25472192 TCCAGGCTTTATAATCTATAAGG - Intergenic
977848531 4:101795509-101795531 TACTGTCTGAAGAATCTCTAAGG + Intronic
985979649 5:3451876-3451898 TCCAAGCTCCAGAATCGCTGAGG + Intergenic
986795455 5:11206743-11206765 TCCAGGCCCTAGAATTTCTTAGG - Intronic
988299775 5:29406876-29406898 TCCAGACTCAAGAAGTTCAAAGG + Intergenic
990299263 5:54434329-54434351 TCCAGGCTCTAGGACCTCTGTGG + Intergenic
992481327 5:77154934-77154956 TCCAGACTCAATGATCACTAAGG - Intergenic
996246364 5:121268869-121268891 TCCCTTCACAAGAATCTCTATGG + Intergenic
998179151 5:139924211-139924233 TCTGGGCTCAAGAATCTCCGGGG + Intronic
1000451849 5:161399332-161399354 TCCAGGCTCACGTTTTTCTATGG + Intronic
1004924860 6:20406122-20406144 TTCTGTCTCAAGAATATCTAAGG + Intronic
1006513001 6:34531812-34531834 TCCAGGCCCAAGCCTCTCTCAGG - Intronic
1011280835 6:85675873-85675895 TCCTTGCTCAAGAATCTTAAGGG + Intergenic
1011492270 6:87904375-87904397 TCCAATCTCAAGAAACTCAAGGG + Intergenic
1014717667 6:124885543-124885565 TCCTGCCTCAATAATCTCTGTGG - Intergenic
1020410230 7:7884081-7884103 TCCAGGCTCAAAAATATGTGTGG - Intronic
1021035687 7:15795481-15795503 TCCAAGAGGAAGAATCTCTAGGG + Intergenic
1021164077 7:17312230-17312252 TCTAGACTCCAGAATCTCTAAGG - Intronic
1022188517 7:27994139-27994161 TTCAAGCTCTAGAATCTCTTTGG + Intronic
1028291801 7:89074959-89074981 TCAAAGTTCACGAATCTCTAGGG - Intronic
1029977252 7:104846512-104846534 TCAAGGCTCTATCATCTCTAAGG - Intronic
1032736139 7:134694306-134694328 CCCAGGCTTACGAGTCTCTAGGG - Intergenic
1035551385 8:529887-529909 TCCAGATTCAAGAATCTCAAAGG - Intronic
1035946323 8:3967369-3967391 TGCAGGCTCATTATTCTCTAGGG + Intronic
1037724301 8:21470570-21470592 TCTAGGCTCAACAATCCCTGAGG - Intergenic
1042963021 8:74322331-74322353 TCCAGGCTCAAGAATCTCTAAGG - Intronic
1045342526 8:101267446-101267468 TCCAGGCTCAAGAAAGAGTAGGG + Intergenic
1049634217 8:143677907-143677929 TCCAGCCCCATGAATTTCTAGGG - Intergenic
1049807580 8:144547929-144547951 TCCAGGCTCAGGAAGCGCTCGGG + Exonic
1052108585 9:24550180-24550202 ACCTGGCTCAAGAAGGTCTAGGG + Intergenic
1053135196 9:35646498-35646520 TCCAGGTTCAGGAATCAATAGGG + Intronic
1056888327 9:90466013-90466035 ACCAGGAACAAGAAACTCTATGG - Intergenic
1057821273 9:98333000-98333022 TCCTGGCTCAGGAATCTCAGAGG - Intronic
1062006865 9:134242949-134242971 TCCAGGCTGCAGCATCTCTGTGG + Intergenic
1186543268 X:10422658-10422680 TCCATGCTCCACAATGTCTAGGG + Intergenic
1190784026 X:53625987-53626009 TCCAGGCTCATCCATCTCTATGG - Intronic
1194037019 X:88887240-88887262 TCCAGGCTCTGGCTTCTCTATGG - Intergenic
1194176540 X:90655979-90656001 TTCACCCTCAAGTATCTCTAAGG - Intergenic
1200523164 Y:4236891-4236913 TTCACCCTCAAGTATCTCTAAGG - Intergenic
1201930747 Y:19343782-19343804 TTCAGGCACAAGAATCACTTGGG - Intergenic