ID: 1042963024

View in Genome Browser
Species Human (GRCh38)
Location 8:74322355-74322377
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042963021_1042963024 1 Left 1042963021 8:74322331-74322353 CCTTAGAGATTCTTGAGCCTGGA 0: 1
1: 0
2: 1
3: 5
4: 119
Right 1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG No data
1042963019_1042963024 23 Left 1042963019 8:74322309-74322331 CCTCGTTTGTGCTTCTTAACAGC 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr