ID: 1042963958

View in Genome Browser
Species Human (GRCh38)
Location 8:74330997-74331019
Sequence TTCCAATAGCATTCATGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042963956_1042963958 0 Left 1042963956 8:74330974-74330996 CCTGTAGCTGCTGCACCTTTGAA 0: 1
1: 0
2: 0
3: 26
4: 173
Right 1042963958 8:74330997-74331019 TTCCAATAGCATTCATGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042963958 Original CRISPR TTCCAATAGCATTCATGCTG AGG Intronic
No off target data available for this crispr