ID: 1042966096

View in Genome Browser
Species Human (GRCh38)
Location 8:74354149-74354171
Sequence CTATAGTTGAAGAGGTAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042966096 Original CRISPR CTATAGTTGAAGAGGTAATC TGG (reversed) Intronic
912118505 1:106438286-106438308 CTATAGTGAAAGAGATGATCTGG - Intergenic
917763205 1:178187122-178187144 ATATAGTTGAAGAAATAAGCCGG - Intronic
919692170 1:200537710-200537732 GTATAGTTGAAGTGGTCATCTGG + Intergenic
924016212 1:239726522-239726544 CTATACCTAAAGAGGTTATCAGG + Intronic
1065225892 10:23543777-23543799 TTATAGTAGCAGAGGGAATCAGG + Intergenic
1067976709 10:51034259-51034281 CTGTAGTTGAAGAGTGCATCAGG + Intronic
1071172353 10:82881107-82881129 CCATAGTTGCTGAGGTAATTTGG - Intronic
1074601402 10:114917476-114917498 ATATAGTTGAAGAAGCCATCAGG - Intergenic
1078377036 11:10804689-10804711 GTATGGTTGAAGAGGTAAATGGG - Intronic
1089936838 11:122373027-122373049 CATTAGTTGAAGAGGAAATCTGG - Intergenic
1090896531 11:130981031-130981053 CCAGACTTGAAGATGTAATCTGG - Intergenic
1090966451 11:131601529-131601551 CTCTAGTTGAAGAGGGATTAGGG + Intronic
1094536999 12:31330168-31330190 GTATAGGTCAAGAAGTAATCTGG + Intergenic
1106626436 13:31425363-31425385 CTGGGGTTGAAGAGGGAATCAGG + Intergenic
1111888228 13:94049814-94049836 CTATAGTTGAAGATGAATTTTGG - Intronic
1114148671 14:20008679-20008701 CTATACTTGAACTGGTAAACTGG + Intergenic
1115622714 14:35156068-35156090 CTATAGCTGAAGAGGCAATGTGG + Intronic
1118625927 14:67658866-67658888 TTATAGTTTAAGAGATATTCAGG - Intronic
1123387422 15:19828718-19828740 CTATGGTTGAAAAGGAAATATGG - Intergenic
1125922511 15:43533774-43533796 CTGTAGTAGTAGAGATAATCAGG - Exonic
1127229585 15:56974720-56974742 CTGTAGTTGAAAAAGTAATGAGG + Intronic
1136392066 16:29971692-29971714 CTGTGGTTGAAGAGGTTCTCGGG - Intronic
1149965639 17:61161323-61161345 ATATTGTTAAAGAGGTATTCTGG + Intronic
926764241 2:16309128-16309150 CTTGAGTTGAAGAGGTAGTTAGG + Intergenic
928957487 2:36885247-36885269 CTTTAGTTGGAAAGGTAACCAGG - Intronic
932274110 2:70438849-70438871 CTAGAGTGGAAGGGGTATTCAGG + Intergenic
933722735 2:85408796-85408818 CTAAAGTTGAAGAGGGGAGCTGG + Intronic
934163347 2:89272707-89272729 CTAGGGTTAAAGAGGTGATCAGG - Intergenic
934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG + Intergenic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
939448993 2:142348201-142348223 CAAAAGTTGAAGAGGTAAGCAGG - Intergenic
939788992 2:146548507-146548529 CTATAGTTGTAGAAGCAAACAGG + Intergenic
940543345 2:155050344-155050366 CCAGAGTTGTAGAGGTAATGAGG + Intergenic
941103567 2:161325786-161325808 ATATTGTTGCAGAGATAATCAGG + Intronic
943238155 2:185348497-185348519 CTACAGTTTAAGAGGAAATTTGG - Intergenic
943252127 2:185538458-185538480 CTATAGTTGAAGAAGCATTTGGG - Intergenic
1169614311 20:7422193-7422215 CTATAGGGAAAGATGTAATCTGG + Intergenic
1170173423 20:13440820-13440842 CTATAGTTGAGTAGGAAATATGG + Intronic
1170630684 20:18062140-18062162 CTATATTTAAAGAGGTAACAAGG - Intergenic
1170961660 20:21030565-21030587 CTACAGTGGAAGAGATAGTCTGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1183842984 22:40515687-40515709 GTAAAGTTGAAGAGGTAGGCAGG + Intronic
951509404 3:23484925-23484947 CTACAGTTGAAGAAGAAATTTGG + Intronic
951749123 3:26014155-26014177 CTATAGTGGAAAAGGAATTCTGG - Intergenic
952861185 3:37813707-37813729 CTGTTCTTGATGAGGTAATCAGG + Intronic
956317600 3:67956018-67956040 CATTAGCTGAAGAGGTAATGTGG + Intergenic
957597511 3:82287321-82287343 CTATAGTTGAAGAAGAAAGAAGG + Intergenic
963214532 3:142729767-142729789 CAATAGTTGAATAGGTAATGAGG + Intronic
964115374 3:153131690-153131712 TTATATGTGAAGAGGTAATATGG - Intergenic
970752738 4:19384446-19384468 CTATAGCTGAAGGGGTAGTGAGG + Intergenic
971792544 4:31186995-31187017 CTATAATTCAAGATGTAATTTGG + Intergenic
976357608 4:84137423-84137445 CAATTGATAAAGAGGTAATCTGG - Intergenic
977247152 4:94646229-94646251 CTATATTTGAAGAGGGCATTTGG + Intronic
977724912 4:100284753-100284775 TTATAGTTGAAAAGGTACTTTGG + Intergenic
979205796 4:118036052-118036074 ATATAGTAGAAGAGATAATCAGG + Intronic
981787360 4:148496920-148496942 CCATAGTTGAGGAAGTAATTTGG - Intergenic
984012417 4:174386011-174386033 CTACAGTTCAAGAGGAAATTTGG + Intergenic
984090868 4:175374000-175374022 CAAGAGTGGAGGAGGTAATCAGG - Intergenic
989482884 5:41952445-41952467 CTATTGTTAAAAAGGTAATAAGG - Intergenic
991763650 5:69949877-69949899 CAACAGTTGAATAGGTATTCAGG - Intergenic
991783675 5:70168249-70168271 CAACAGTTGAATAGGTATTCAGG + Intergenic
991842881 5:70824945-70824967 CAACAGTTGAATAGGTATTCAGG - Intergenic
991876121 5:71168608-71168630 CAACAGTTGAATAGGTATTCAGG + Intergenic
992073608 5:73171477-73171499 TTATAGTTAAAGAGAAAATCTGG + Intergenic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
993431650 5:87840554-87840576 TTATAGTTGAAGAAGTCATATGG - Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996166985 5:120236317-120236339 CTCTAGTTGGAGAGGTAGTGTGG + Intergenic
997602108 5:135147661-135147683 CTATAATTGAAGATGAAATTTGG + Intronic
998183565 5:139962065-139962087 ATAGAGTAGAAGAGGCAATCAGG - Intronic
1000510977 5:162182794-162182816 CTAAAATTAAAGATGTAATCTGG - Intergenic
1002253190 5:177942090-177942112 CTATAGTTGCTGAGGCCATCAGG + Intergenic
1003442674 6:6158475-6158497 CTATAGGTGAGGAGGTTCTCAGG - Intronic
1004317996 6:14608132-14608154 CTATAGTCCAAGAGATATTCTGG + Intergenic
1004578446 6:16923087-16923109 CTATAGATGAAGAGGTAGGTAGG + Intergenic
1004835325 6:19524652-19524674 CTATACTGGAAGATGTAATTGGG - Intergenic
1012326251 6:97921838-97921860 CTATATTTGAATAGATAGTCTGG + Intergenic
1013729585 6:113148659-113148681 CTATAGTTGATGTGATAATCTGG + Intergenic
1014462774 6:121717627-121717649 GTAAAGTTGAAGAGGTAGTAGGG - Intergenic
1021079521 7:16347582-16347604 CTATGGGTGAAGGGGGAATCTGG - Intronic
1021602073 7:22374108-22374130 CTATATAAGAAGAGGAAATCTGG - Intergenic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1022434962 7:30374259-30374281 CTATGTCTGAAGAGGTAAACAGG + Intronic
1027353331 7:77333687-77333709 ATATAGTTAAAGAGGTAGTTAGG + Intronic
1030433559 7:109485111-109485133 TTATAGATGGAGAGGTAATTAGG + Intergenic
1031728465 7:125267099-125267121 CTATAGTTCAAGATGAAATTTGG - Intergenic
1032474943 7:132205212-132205234 CTAAAGTGGAAGAGGTTTTCAGG - Intronic
1032643032 7:133790977-133790999 CTTTAGTTGTAGACGTAATTAGG + Intronic
1033657736 7:143384393-143384415 CTATACTTGGAGAGGCAAGCGGG + Intronic
1033811773 7:145021961-145021983 CTACAGTTTAAAAGGTTATCAGG + Intergenic
1036478851 8:9119958-9119980 CTCTAGTGGATGAGGTTATCAGG - Intergenic
1037168424 8:15859452-15859474 CTATAGTAGAATAAATAATCAGG + Intergenic
1042524491 8:69750101-69750123 ATAAAGTCGAAGAGGTAACCAGG + Intronic
1042966096 8:74354149-74354171 CTATAGTTGAAGAGGTAATCTGG - Intronic
1043412357 8:80010901-80010923 CTAGAGCTGAAAAGGTAACCAGG + Intronic
1043752760 8:83961054-83961076 CTCTAGATGAAAAGGTAGTCTGG - Intergenic
1050712327 9:8479486-8479508 CTATATTTGAAAAGGGAGTCAGG - Intronic
1050794988 9:9527740-9527762 CTATAGTTACAGAAGTAATTGGG + Intronic
1052484338 9:29076809-29076831 TTATAATTAAAGAGGTAATAAGG + Intergenic
1055332886 9:75202275-75202297 CTTTAGAAGAAGAGGTGATCTGG - Intergenic
1055571337 9:77620161-77620183 CTATTGTTGAAGAGTTAACACGG + Intronic
1059611129 9:115896978-115897000 CTATAGAGGAAGAGGAAATCAGG + Intergenic
1185974239 X:4701378-4701400 CTACAGTTGAAGATGTGATTTGG - Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188961773 X:36501663-36501685 CTACAGTTCAAGATGTAATGTGG + Intergenic
1190802968 X:53809473-53809495 CATTAGTTGAAGTGGTAATGTGG - Intergenic
1195780638 X:108459769-108459791 CTATAGTTAAATAGATACTCTGG - Intronic
1197390850 X:125862044-125862066 CTATATTTGAGGAAGAAATCCGG + Intergenic
1198239073 X:134765602-134765624 CTATAGCTGTAGATGTAAACAGG - Intergenic