ID: 1042968263

View in Genome Browser
Species Human (GRCh38)
Location 8:74379146-74379168
Sequence TGCCCTCAAAAAGCCTGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042968263_1042968264 -1 Left 1042968263 8:74379146-74379168 CCGACTCAGGCTTTTTGAGGGCA No data
Right 1042968264 8:74379168-74379190 AGTTCCAACTTTCAAATATGAGG No data
1042968263_1042968267 16 Left 1042968263 8:74379146-74379168 CCGACTCAGGCTTTTTGAGGGCA No data
Right 1042968267 8:74379185-74379207 ATGAGGGTTCCATATGAATTTGG No data
1042968263_1042968265 0 Left 1042968263 8:74379146-74379168 CCGACTCAGGCTTTTTGAGGGCA No data
Right 1042968265 8:74379169-74379191 GTTCCAACTTTCAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042968263 Original CRISPR TGCCCTCAAAAAGCCTGAGT CGG (reversed) Intronic