ID: 1042968265

View in Genome Browser
Species Human (GRCh38)
Location 8:74379169-74379191
Sequence GTTCCAACTTTCAAATATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042968259_1042968265 14 Left 1042968259 8:74379132-74379154 CCGACTTTCAGGGTCCGACTCAG No data
Right 1042968265 8:74379169-74379191 GTTCCAACTTTCAAATATGAGGG No data
1042968263_1042968265 0 Left 1042968263 8:74379146-74379168 CCGACTCAGGCTTTTTGAGGGCA No data
Right 1042968265 8:74379169-74379191 GTTCCAACTTTCAAATATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042968265 Original CRISPR GTTCCAACTTTCAAATATGA GGG Intronic