ID: 1042968265 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:74379169-74379191 |
Sequence | GTTCCAACTTTCAAATATGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1042968259_1042968265 | 14 | Left | 1042968259 | 8:74379132-74379154 | CCGACTTTCAGGGTCCGACTCAG | No data | ||
Right | 1042968265 | 8:74379169-74379191 | GTTCCAACTTTCAAATATGAGGG | No data | ||||
1042968263_1042968265 | 0 | Left | 1042968263 | 8:74379146-74379168 | CCGACTCAGGCTTTTTGAGGGCA | No data | ||
Right | 1042968265 | 8:74379169-74379191 | GTTCCAACTTTCAAATATGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1042968265 | Original CRISPR | GTTCCAACTTTCAAATATGA GGG | Intronic | ||