ID: 1042968267 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:74379185-74379207 |
| Sequence | ATGAGGGTTCCATATGAATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1042968263_1042968267 | 16 | Left | 1042968263 | 8:74379146-74379168 | CCGACTCAGGCTTTTTGAGGGCA | No data | ||
| Right | 1042968267 | 8:74379185-74379207 | ATGAGGGTTCCATATGAATTTGG | No data | ||||
| 1042968266_1042968267 | -10 | Left | 1042968266 | 8:74379172-74379194 | CCAACTTTCAAATATGAGGGTTC | No data | ||
| Right | 1042968267 | 8:74379185-74379207 | ATGAGGGTTCCATATGAATTTGG | No data | ||||
| 1042968259_1042968267 | 30 | Left | 1042968259 | 8:74379132-74379154 | CCGACTTTCAGGGTCCGACTCAG | No data | ||
| Right | 1042968267 | 8:74379185-74379207 | ATGAGGGTTCCATATGAATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1042968267 | Original CRISPR | ATGAGGGTTCCATATGAATT TGG | Intronic | ||