ID: 1042976518

View in Genome Browser
Species Human (GRCh38)
Location 8:74476528-74476550
Sequence AGACTAAGCTTCATAAGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12455
Summary {0: 6, 1: 587, 2: 1107, 3: 7056, 4: 3699}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042976518_1042976522 2 Left 1042976518 8:74476528-74476550 CCTTTGCTTATGAAGCTTAGTCT 0: 6
1: 587
2: 1107
3: 7056
4: 3699
Right 1042976522 8:74476553-74476575 CAGGATATGAAAGCTGTGGTTGG No data
1042976518_1042976521 -2 Left 1042976518 8:74476528-74476550 CCTTTGCTTATGAAGCTTAGTCT 0: 6
1: 587
2: 1107
3: 7056
4: 3699
Right 1042976521 8:74476549-74476571 CTGGCAGGATATGAAAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042976518 Original CRISPR AGACTAAGCTTCATAAGCAA AGG (reversed) Intronic
Too many off-targets to display for this crispr