ID: 1042976522

View in Genome Browser
Species Human (GRCh38)
Location 8:74476553-74476575
Sequence CAGGATATGAAAGCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042976518_1042976522 2 Left 1042976518 8:74476528-74476550 CCTTTGCTTATGAAGCTTAGTCT 0: 6
1: 587
2: 1107
3: 7056
4: 3699
Right 1042976522 8:74476553-74476575 CAGGATATGAAAGCTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042976522 Original CRISPR CAGGATATGAAAGCTGTGGT TGG Intronic
No off target data available for this crispr