ID: 1042978036

View in Genome Browser
Species Human (GRCh38)
Location 8:74492683-74492705
Sequence CAGAAATAAGAGAAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042978036_1042978038 11 Left 1042978036 8:74492683-74492705 CCTGCCTGCTTCTCTTATTTCTG No data
Right 1042978038 8:74492717-74492739 TCATTTGAGTTTGAGATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042978036 Original CRISPR CAGAAATAAGAGAAGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr