ID: 1042980353

View in Genome Browser
Species Human (GRCh38)
Location 8:74519357-74519379
Sequence TGGGCCTCACCTAAGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042980353_1042980358 13 Left 1042980353 8:74519357-74519379 CCACAGGCCTTAGGTGAGGCCCA No data
Right 1042980358 8:74519393-74519415 TTCTGACGTCAGGTTTGACCTGG No data
1042980353_1042980357 3 Left 1042980353 8:74519357-74519379 CCACAGGCCTTAGGTGAGGCCCA No data
Right 1042980357 8:74519383-74519405 CTGTGCTGACTTCTGACGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042980353 Original CRISPR TGGGCCTCACCTAAGGCCTG TGG (reversed) Intergenic
No off target data available for this crispr