ID: 1042985931

View in Genome Browser
Species Human (GRCh38)
Location 8:74582882-74582904
Sequence TTACAAAAACAGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042985923_1042985931 30 Left 1042985923 8:74582829-74582851 CCAGAGACAATATGTAAACAGAT No data
Right 1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG No data
1042985927_1042985931 4 Left 1042985927 8:74582855-74582877 CCTGGCTGTGTTCTGCGAAAACT No data
Right 1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG No data
1042985926_1042985931 5 Left 1042985926 8:74582854-74582876 CCCTGGCTGTGTTCTGCGAAAAC No data
Right 1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042985931 Original CRISPR TTACAAAAACAGATGGAGGT GGG Intergenic
No off target data available for this crispr