ID: 1042994337

View in Genome Browser
Species Human (GRCh38)
Location 8:74678808-74678830
Sequence CAGACTTTCAACTATGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042994337_1042994338 23 Left 1042994337 8:74678808-74678830 CCAATCTCATAGTTGAAAGTCTG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 1042994338 8:74678854-74678876 TAATTCATAGTGAACAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042994337 Original CRISPR CAGACTTTCAACTATGAGAT TGG (reversed) Intronic
901775287 1:11556342-11556364 CATAAATTTAACTATGAGATGGG - Intergenic
907948039 1:59153718-59153740 CAGACTTTCTCCTAAGTGATGGG - Intergenic
911056333 1:93711440-93711462 CAGAGTTTCAAGAATGAGAATGG + Intronic
916965432 1:169936260-169936282 AAAACTTTCACCCATGAGATGGG + Intronic
917618659 1:176772284-176772306 CAGGCTTTCAACTAAGTGCTAGG - Intronic
919703327 1:200653455-200653477 CAGTCTTGCAAATATGAGTTGGG - Intronic
919952822 1:202381517-202381539 CTGGCTTTCAATTATGACATAGG + Intronic
921623688 1:217354544-217354566 CAGACTTTCAACTGCTAGAGTGG + Intergenic
923638819 1:235730189-235730211 CAGTTTTTCATCTATGAAATGGG + Intronic
924453480 1:244199470-244199492 CAGACCTTCAAGAATGAGATTGG - Intergenic
1065897326 10:30175500-30175522 CAGTTTTTCAACTAAGAAATGGG - Intergenic
1069037807 10:63663779-63663801 CATACTTTGAACTAGGACATCGG + Intergenic
1073254488 10:102141983-102142005 CAGGCTTTCATCAGTGAGATTGG + Exonic
1074273412 10:111977546-111977568 CATAATTAAAACTATGAGATTGG + Intergenic
1074758474 10:116646238-116646260 CACACTTTCACCTATCAAATTGG - Intergenic
1081324939 11:41732739-41732761 CAGAATTTCAACTAATAGAAGGG - Intergenic
1085008866 11:73121291-73121313 CAGTATTTGAAATATGAGATGGG - Intronic
1087130955 11:94668883-94668905 CAGGTTTTCATCCATGAGATGGG + Intergenic
1088427767 11:109723584-109723606 TAGGATTTCAACTATGAGTTTGG + Intergenic
1092101080 12:5884364-5884386 CAGACTTTAAATTATGGGCTTGG - Intronic
1092390906 12:8078011-8078033 CACTCTTTCCACTGTGAGATAGG - Intergenic
1094000571 12:25689931-25689953 CAGACTTCTACCTATGAGGTGGG + Intergenic
1094564506 12:31587997-31588019 TAGGCTTTTAACTCTGAGATGGG - Intronic
1096790343 12:54040422-54040444 CAGCCTTCCAAATCTGAGATAGG - Intronic
1099030135 12:77516041-77516063 CAGAGTTTTAAGTAAGAGATGGG + Intergenic
1099210578 12:79783159-79783181 CAGAATTTCAAATATGAGGCTGG + Intronic
1100721715 12:97366022-97366044 AAGACTTGCAACTTTGAGACTGG + Intergenic
1101820739 12:108182355-108182377 GAGAATTTCAACTTTGACATGGG + Intronic
1104564155 12:129865168-129865190 CAGACTGTCACCAATGAGAGAGG - Intronic
1107044921 13:35984005-35984027 CAGGCCTTCCACTATGAAATGGG + Intronic
1107165154 13:37275118-37275140 GAAACTTTCAACTATGGCATTGG - Intergenic
1108732771 13:53252128-53252150 TAGACTTTCAAATATGTGAGTGG - Intergenic
1108764287 13:53607590-53607612 CAGAGTTTCATCTAAGAGCTGGG - Intergenic
1108893368 13:55292101-55292123 CAGACTTTAAACAATGGAATAGG + Intergenic
1109068798 13:57736459-57736481 CAGACTTTCAACTTTGCCACTGG - Intergenic
1110225638 13:73116833-73116855 CAGACTTTGATCCAAGAGATTGG + Intergenic
1112620645 13:101050744-101050766 CAGAAGTTCAACTTTGAGGTTGG + Intergenic
1114420061 14:22574534-22574556 AAGACTTTAAAATATAAGATGGG - Intronic
1115292630 14:31789833-31789855 CAGGCTGTAAAATATGAGATGGG + Intronic
1117398268 14:55333888-55333910 CAGGCATTCAGCTATGAGTTAGG - Intronic
1117742090 14:58828830-58828852 CAGTTTTTCACCTATGAAATGGG + Intergenic
1117950077 14:61074135-61074157 CAGATTTTCAACTGTGTGGTGGG + Intronic
1118612747 14:67554267-67554289 CAGAATTTCAGCTGAGAGATTGG + Intronic
1122663643 14:103314383-103314405 CAGAATTCCAACTATGTTATAGG - Intergenic
1124467447 15:29950842-29950864 GAGACTTCCTACTATGAGACTGG - Intronic
1124924457 15:34057583-34057605 CAGATTTTAAACTTTGAGGTGGG - Intronic
1125004611 15:34803080-34803102 CAGCCATTAAACTATGATATGGG + Intergenic
1125493948 15:40172335-40172357 CAGACTTTCAACTGGGTGAGGGG - Intronic
1126079824 15:44949033-44949055 CAGTCGGTCAACTATGAGAGAGG + Intergenic
1130184422 15:81666088-81666110 CAGACTTTCAAATAAGTGCTGGG + Intergenic
1131119103 15:89812259-89812281 CTGACTGTGAACTATGAGACTGG + Intronic
1133873224 16:9709073-9709095 CAGAAATTCCACTATGAGAAAGG - Intergenic
1135590698 16:23702995-23703017 CAGTCCATCAACTATGAGATAGG + Intronic
1140583973 16:76265755-76265777 AAGACTTTCAACAACCAGATGGG - Intergenic
1142326427 16:89418283-89418305 CTGACTTTCAGCTATGGAATCGG - Exonic
1143311908 17:5999011-5999033 CAGTCTTTCCACTCAGAGATGGG - Intronic
1150798106 17:68255697-68255719 CAGACTTTAACCCATGAGATCGG + Exonic
1151738003 17:75957918-75957940 CATACTTGCAACTCAGAGATGGG - Intronic
1155125791 18:22874270-22874292 CATAGTTTCATCTATGAAATTGG + Intronic
1156649774 18:39212065-39212087 CAGATTTTCAACTTTGTGAGGGG - Intergenic
1158784651 18:60695273-60695295 CAGAGTTTCACCAATGACATTGG + Intergenic
1159212583 18:65345436-65345458 CAGAAATTTAAGTATGAGATTGG + Intergenic
1159398722 18:67901288-67901310 TAAACTTTCAATTATCAGATGGG + Intergenic
1162859305 19:13493655-13493677 CAGAGTTTCAATTATGGGCTTGG + Intronic
1163807950 19:19411370-19411392 CGGACTTCCATCTGTGAGATGGG + Intronic
1164127142 19:22328837-22328859 CACAATTTCAACTGTGAGCTGGG - Intergenic
1164299100 19:23943651-23943673 CAGACTTTAAAATGTGATATGGG + Intronic
1166158312 19:40932308-40932330 GAGACCTTCACCTATGTGATGGG - Intergenic
1167939682 19:52936601-52936623 CAGACATTCTATTCTGAGATAGG + Intronic
925824145 2:7830712-7830734 CAGACTTTATTCTAAGAGATGGG - Intergenic
927372729 2:22375860-22375882 CTGTCTTTCAACTCTGAGATAGG + Intergenic
929990666 2:46783633-46783655 CAGACTCTCAGCCATGGGATGGG + Intergenic
931435342 2:62241036-62241058 CAGAAGGTCAACTATGAGAAAGG - Intergenic
932895610 2:75636753-75636775 CAGACTTTCAACTGTGTGGGAGG - Intergenic
936660519 2:114537902-114537924 CAGACTTCCAAGTAAGAGAGAGG - Intronic
937525439 2:122763260-122763282 GAGAATTTCAACAACGAGATGGG - Intergenic
938314542 2:130316840-130316862 CACCCTTTGAACTCTGAGATGGG - Intergenic
939264204 2:139850727-139850749 CAGACTTGCAACTTAGATATAGG + Intergenic
940042129 2:149371762-149371784 CAGACTTTCCAGTAAGAAATGGG + Intronic
942423204 2:175830118-175830140 CTGACTGGCAACGATGAGATTGG - Intergenic
943393468 2:187301040-187301062 AAGCCTTTCAACCATGATATTGG - Intergenic
945270271 2:207931289-207931311 CAGACATTCAACTGTAAGCTAGG + Intronic
945483491 2:210368328-210368350 CAGACTTTCAACTGTGTAATAGG + Intergenic
945560640 2:211335593-211335615 CAGATTATCAAATATGAGAAGGG - Intergenic
948730559 2:239961239-239961261 TAGACATTGAACTATGAGCTGGG - Intronic
1170054063 20:12179508-12179530 CAGACTTTTAGATATGAGAATGG + Intergenic
1172710159 20:36915770-36915792 CAGATTTTCAACTAGGAGAGGGG + Intronic
1173428692 20:42966557-42966579 CAGAGTTTCTACTATAAGTTGGG - Intronic
1179357604 21:40675236-40675258 CACACTTTCATCTGTCAGATTGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
954998760 3:54906708-54906730 CTGAATGTCAACTATGAGATGGG + Intronic
955443286 3:58980065-58980087 CAGGCTTTCAACTATGGCAGTGG - Intronic
955454232 3:59102158-59102180 GAGGCTTTTAACTATGTGATAGG - Intergenic
957833166 3:85550075-85550097 CAGCCTTTTACCGATGAGATAGG + Intronic
958796838 3:98715018-98715040 CAAAAATTCAACTAAGAGATAGG - Intergenic
961494254 3:127279434-127279456 TATACTTTCATCTAAGAGATTGG + Intergenic
961733245 3:128983386-128983408 CAGATCTTCATCTGTGAGATGGG - Intronic
962175475 3:133149460-133149482 CAAACTTTCAGTTATAAGATGGG - Intronic
963874783 3:150462977-150462999 CAAACTTTCAAGTATGAGTTGGG - Exonic
964086840 3:152828901-152828923 CACAGTTTTAAGTATGAGATGGG - Intergenic
967378639 3:188832882-188832904 CAGACTTGCAACTGTTAGAATGG - Intronic
969127670 4:4965015-4965037 CAGACTTTCATCTCTTTGATTGG - Intergenic
969555829 4:7909246-7909268 CTGACTTTCATCTATGAAATGGG - Intronic
970046420 4:11859562-11859584 GAGACTTACTACCATGAGATAGG - Intergenic
970222269 4:13823482-13823504 CAGTCCTTCATCTATGAGTTAGG + Intergenic
972250027 4:37290063-37290085 CTTACTTTCAACTATGAGAAAGG - Intronic
975162685 4:71141939-71141961 CAGCCTTTCAATTAAAAGATGGG - Intergenic
976125448 4:81829325-81829347 CAAACTTTTAACTATAATATGGG - Intronic
976184666 4:82431328-82431350 CAGTCTTTCCATTTTGAGATCGG - Intronic
976459354 4:85290380-85290402 CAGACTTTGAACTAAGAATTTGG - Intergenic
979514449 4:121591278-121591300 CAACCTTTAAACTGTGAGATTGG + Intergenic
980160693 4:129158209-129158231 CAGCCTCTAAACTATGAGATAGG + Intergenic
980643232 4:135606527-135606549 CAGAAATTTAACTATGAAATTGG + Intergenic
980923980 4:139115708-139115730 GAGACTATCAACTTTAAGATAGG - Intronic
982527751 4:156501269-156501291 CAGATTTTCAAACATGAGAAAGG + Intergenic
982530875 4:156541843-156541865 CAGCCTTTTAATTATAAGATTGG + Intergenic
983816340 4:172132413-172132435 CAGCAGTTCAACTCTGAGATTGG + Intronic
983833484 4:172360842-172360864 CAGACTTTCACCCAGAAGATAGG + Intronic
987519461 5:18960976-18960998 TTATCTTTCAACTATGAGATAGG - Intergenic
987603342 5:20101750-20101772 CAGCCTTTCTATTATCAGATTGG - Intronic
987922510 5:24301941-24301963 CAGGCTTTGGACTATGACATGGG - Intergenic
988325827 5:29766209-29766231 CAGACTTTGAAGAATGAGTTAGG + Intergenic
989985888 5:50697377-50697399 CAGGATTTGAAATATGAGATAGG - Intronic
990149036 5:52795963-52795985 CAGTCTTTCACCTCTGAAATGGG + Intronic
993221245 5:85100243-85100265 AAAAATTTCAACTGTGAGATGGG + Intergenic
997628607 5:135349053-135349075 CAGAGTTGCAGCTTTGAGATAGG - Intronic
1000495924 5:161984581-161984603 CAAACTTTAGACTATGAAATTGG + Intergenic
1001711094 5:173778638-173778660 CAGATTTTCAACTCTGAGGGGGG - Intergenic
1004298178 6:14433301-14433323 CAAACTAACAAGTATGAGATTGG + Intergenic
1007444332 6:41894132-41894154 CAGAATTTAAAGGATGAGATGGG - Exonic
1010365153 6:75041876-75041898 GAGAATTTCAACAAGGAGATTGG + Intergenic
1012112205 6:95250983-95251005 CAGAAGTTGAAATATGAGATGGG + Intergenic
1012907177 6:105081045-105081067 CCAACTTTCAACCATAAGATAGG - Exonic
1013985583 6:116188854-116188876 CAGAGTATCAGCTATGAAATAGG - Intronic
1014333719 6:120103592-120103614 CAGAGAATCCACTATGAGATGGG - Intergenic
1014882366 6:126739122-126739144 GAGAATTCCAACTATGAGGTTGG - Intergenic
1020729287 7:11861318-11861340 CATATTTTAAACTATGAAATAGG + Intergenic
1022853052 7:34285074-34285096 CACACTTTGATCTATGAGGTAGG + Intergenic
1024627694 7:51222443-51222465 CACACTTTCAGCTATAAAATAGG - Intronic
1024921387 7:54559359-54559381 CAGATTTGCAATTCTGAGATGGG - Intronic
1024935301 7:54705910-54705932 CAGACTTCCAGTTATAAGATGGG + Intergenic
1026907994 7:74074088-74074110 CAGACTGTAAACTCTAAGATGGG + Intergenic
1027998847 7:85464946-85464968 CAGACTTTCAGCTGTAAGATGGG + Intergenic
1031157717 7:118129334-118129356 CAGTCTTTCAACTCTGACACAGG + Intergenic
1031658621 7:124392038-124392060 CAGACTTTCACCTATAATCTTGG + Intergenic
1032176957 7:129638270-129638292 CAGACTTGTAACTATGAAAGGGG - Intronic
1033417043 7:141171306-141171328 TAGACTTTTTACTATGTGATAGG + Intronic
1037518083 8:19653449-19653471 GAGACTTACAGCTATGGGATTGG - Intronic
1039177421 8:34825408-34825430 CACACTTCCAAGGATGAGATTGG + Intergenic
1039764290 8:40611963-40611985 CAGCCTTTCAACAATGACAGTGG - Intronic
1040137673 8:43874204-43874226 AAGAAATTTAACTATGAGATAGG - Intergenic
1040651582 8:49455173-49455195 CAGACTTTCAGTTATAAGACTGG + Intergenic
1041554971 8:59143320-59143342 CAGACTTTAAACAAAGTGATAGG + Intergenic
1042994337 8:74678808-74678830 CAGACTTTCAACTATGAGATTGG - Intronic
1050125255 9:2349968-2349990 CAGTTTTTCATCTATCAGATTGG - Intergenic
1052107698 9:24539683-24539705 CAGAAGATCAACTATTAGATTGG - Intergenic
1052273261 9:26650189-26650211 CTGACATACAGCTATGAGATTGG + Intergenic
1053736413 9:41105733-41105755 CATTCGTTCAACTCTGAGATAGG + Intergenic
1054879648 9:70131371-70131393 CAGATTTCCAAATATGAGTTTGG - Intronic
1056614909 9:88156553-88156575 CAGAATATCAACTAAGAAATCGG - Intergenic
1060538440 9:124411801-124411823 CATCCTTTTAACTCTGAGATAGG - Intronic
1194738000 X:97537345-97537367 TAGACATTCAAATATAAGATAGG - Intronic
1195239982 X:102941513-102941535 CAGATTTTCATCTACGAAATGGG - Intergenic
1197494898 X:127166767-127166789 CAGCATTTCTACTATGAGAAAGG + Intergenic
1198076224 X:133195564-133195586 CACAATATCAACTATGACATGGG + Intergenic
1198614911 X:138446210-138446232 GAGAGATTTAACTATGAGATTGG - Intergenic
1201552945 Y:15237898-15237920 GAGATTTTCAACTTTGACATTGG + Intergenic
1202248093 Y:22840088-22840110 CACACTTTCACCTATGAGCTGGG - Intergenic
1202401081 Y:24473836-24473858 CACACTTTCACCTATGAGCTGGG - Intergenic
1202469699 Y:25196250-25196272 CACACTTTCACCTATGAGCTGGG + Intergenic