ID: 1042998253

View in Genome Browser
Species Human (GRCh38)
Location 8:74725281-74725303
Sequence AGCAGTATAAAGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1042998250_1042998253 -1 Left 1042998250 8:74725259-74725281 CCTGTGTTCACAGTTGGCTGATA 0: 1
1: 0
2: 1
3: 9
4: 155
Right 1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG No data
1042998248_1042998253 14 Left 1042998248 8:74725244-74725266 CCATGGGACTTTTGTCCTGTGTT 0: 1
1: 0
2: 0
3: 30
4: 265
Right 1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG No data
1042998247_1042998253 15 Left 1042998247 8:74725243-74725265 CCCATGGGACTTTTGTCCTGTGT 0: 1
1: 0
2: 1
3: 7
4: 150
Right 1042998253 8:74725281-74725303 AGCAGTATAAAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1042998253 Original CRISPR AGCAGTATAAAGAAGGATGG AGG Intronic
No off target data available for this crispr