ID: 1043001536

View in Genome Browser
Species Human (GRCh38)
Location 8:74766019-74766041
Sequence TGTCCTTTGCAGGAACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043001533_1043001536 -2 Left 1043001533 8:74765998-74766020 CCATAAAAAAGAATGAGATCATG 0: 897
1: 4626
2: 12822
3: 22337
4: 12272
Right 1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG No data
1043001532_1043001536 16 Left 1043001532 8:74765980-74766002 CCATAGAATTCTATGAGGCCATA 0: 1
1: 0
2: 36
3: 1305
4: 27312
Right 1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043001536 Original CRISPR TGTCCTTTGCAGGAACAGGA TGG Intronic
No off target data available for this crispr