ID: 1043006814

View in Genome Browser
Species Human (GRCh38)
Location 8:74830095-74830117
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043006811_1043006814 -1 Left 1043006811 8:74830073-74830095 CCAGAGAGGTGGTAACTCCCGAG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1043006814 8:74830095-74830117 GTAAGCAATGCCAATCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr