ID: 1043011349

View in Genome Browser
Species Human (GRCh38)
Location 8:74885327-74885349
Sequence TTGCATTCCCTCTGCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043011349_1043011353 7 Left 1043011349 8:74885327-74885349 CCTCCTCCGCAGAGGGAATGCAA No data
Right 1043011353 8:74885357-74885379 CTCAAAAGAGAAATAGATAGAGG No data
1043011349_1043011354 8 Left 1043011349 8:74885327-74885349 CCTCCTCCGCAGAGGGAATGCAA No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data
1043011349_1043011355 9 Left 1043011349 8:74885327-74885349 CCTCCTCCGCAGAGGGAATGCAA No data
Right 1043011355 8:74885359-74885381 CAAAAGAGAAATAGATAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043011349 Original CRISPR TTGCATTCCCTCTGCGGAGG AGG (reversed) Intergenic
No off target data available for this crispr