ID: 1043011350

View in Genome Browser
Species Human (GRCh38)
Location 8:74885330-74885352
Sequence CTCTTGCATTCCCTCTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043011350_1043011355 6 Left 1043011350 8:74885330-74885352 CCTCCGCAGAGGGAATGCAAGAG No data
Right 1043011355 8:74885359-74885381 CAAAAGAGAAATAGATAGAGGGG No data
1043011350_1043011353 4 Left 1043011350 8:74885330-74885352 CCTCCGCAGAGGGAATGCAAGAG No data
Right 1043011353 8:74885357-74885379 CTCAAAAGAGAAATAGATAGAGG No data
1043011350_1043011356 28 Left 1043011350 8:74885330-74885352 CCTCCGCAGAGGGAATGCAAGAG No data
Right 1043011356 8:74885381-74885403 GAGAAGAAACTAGAGAATTTAGG No data
1043011350_1043011354 5 Left 1043011350 8:74885330-74885352 CCTCCGCAGAGGGAATGCAAGAG No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043011350 Original CRISPR CTCTTGCATTCCCTCTGCGG AGG (reversed) Intergenic
No off target data available for this crispr