ID: 1043011351

View in Genome Browser
Species Human (GRCh38)
Location 8:74885333-74885355
Sequence TTGCTCTTGCATTCCCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043011351_1043011354 2 Left 1043011351 8:74885333-74885355 CCGCAGAGGGAATGCAAGAGCAA No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data
1043011351_1043011353 1 Left 1043011351 8:74885333-74885355 CCGCAGAGGGAATGCAAGAGCAA No data
Right 1043011353 8:74885357-74885379 CTCAAAAGAGAAATAGATAGAGG No data
1043011351_1043011355 3 Left 1043011351 8:74885333-74885355 CCGCAGAGGGAATGCAAGAGCAA No data
Right 1043011355 8:74885359-74885381 CAAAAGAGAAATAGATAGAGGGG No data
1043011351_1043011356 25 Left 1043011351 8:74885333-74885355 CCGCAGAGGGAATGCAAGAGCAA No data
Right 1043011356 8:74885381-74885403 GAGAAGAAACTAGAGAATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043011351 Original CRISPR TTGCTCTTGCATTCCCTCTG CGG (reversed) Intergenic