ID: 1043011354

View in Genome Browser
Species Human (GRCh38)
Location 8:74885358-74885380
Sequence TCAAAAGAGAAATAGATAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043011350_1043011354 5 Left 1043011350 8:74885330-74885352 CCTCCGCAGAGGGAATGCAAGAG No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data
1043011351_1043011354 2 Left 1043011351 8:74885333-74885355 CCGCAGAGGGAATGCAAGAGCAA No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data
1043011349_1043011354 8 Left 1043011349 8:74885327-74885349 CCTCCTCCGCAGAGGGAATGCAA No data
Right 1043011354 8:74885358-74885380 TCAAAAGAGAAATAGATAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043011354 Original CRISPR TCAAAAGAGAAATAGATAGA GGG Intergenic
No off target data available for this crispr