ID: 1043013495

View in Genome Browser
Species Human (GRCh38)
Location 8:74909502-74909524
Sequence TCCAGCTAGTGCCCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043013492_1043013495 23 Left 1043013492 8:74909456-74909478 CCTATAGGGTGAGATTCTAACAG No data
Right 1043013495 8:74909502-74909524 TCCAGCTAGTGCCCACATGCTGG No data
1043013491_1043013495 28 Left 1043013491 8:74909451-74909473 CCTCACCTATAGGGTGAGATTCT No data
Right 1043013495 8:74909502-74909524 TCCAGCTAGTGCCCACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043013495 Original CRISPR TCCAGCTAGTGCCCACATGC TGG Intergenic
No off target data available for this crispr