ID: 1043013495 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:74909502-74909524 |
| Sequence | TCCAGCTAGTGCCCACATGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043013492_1043013495 | 23 | Left | 1043013492 | 8:74909456-74909478 | CCTATAGGGTGAGATTCTAACAG | No data | ||
| Right | 1043013495 | 8:74909502-74909524 | TCCAGCTAGTGCCCACATGCTGG | No data | ||||
| 1043013491_1043013495 | 28 | Left | 1043013491 | 8:74909451-74909473 | CCTCACCTATAGGGTGAGATTCT | No data | ||
| Right | 1043013495 | 8:74909502-74909524 | TCCAGCTAGTGCCCACATGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043013495 | Original CRISPR | TCCAGCTAGTGCCCACATGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||