ID: 1043020267

View in Genome Browser
Species Human (GRCh38)
Location 8:74991430-74991452
Sequence CTTTATAAGCTAATCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043020267_1043020272 9 Left 1043020267 8:74991430-74991452 CCCACCATGATTAGCTTATAAAG 0: 1
1: 0
2: 2
3: 15
4: 175
Right 1043020272 8:74991462-74991484 TTGTCCAGTCTGCCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043020267 Original CRISPR CTTTATAAGCTAATCATGGT GGG (reversed) Intronic
903853640 1:26322566-26322588 CTTTGGAAGCCAATCATGGAAGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910491824 1:87780915-87780937 CTTTATAAACTACACTTGGTAGG + Intergenic
911923101 1:103792460-103792482 TAATATAAGCTAATCATGGGAGG - Intergenic
913472095 1:119198641-119198663 TTTTATTATTTAATCATGGTAGG - Intergenic
915563636 1:156701840-156701862 CTTCAAAAGCCAATCAAGGTTGG + Intronic
917341911 1:173988596-173988618 CTTTATAAGCTTAACATAGTAGG - Intronic
918213835 1:182375697-182375719 CTTTATAAGCTAATCTTGGAAGG - Intergenic
919564245 1:199163757-199163779 CTTTAAAAGATAAACAGGGTAGG + Intergenic
921461941 1:215438132-215438154 CTTTATGATTTAATCTTGGTAGG + Intergenic
1066037278 10:31505486-31505508 CTTTCTAATTTAATCTTGGTAGG + Intronic
1066116172 10:32242448-32242470 CTTTATAAACTAGTTTTGGTGGG + Intergenic
1067681312 10:48443092-48443114 CTATGTAAGGTAATCATGTTTGG + Intergenic
1068027467 10:51664961-51664983 TTTTAAAAGCTGCTCATGGTTGG + Intronic
1068397621 10:56484757-56484779 TTTTATAATCTAATCTTGGAAGG - Intergenic
1068436377 10:56996618-56996640 CTTCATAATTTAATCTTGGTAGG - Intergenic
1068511774 10:57975253-57975275 CTTTATAATTTAATCTTGGTAGG - Intergenic
1070364172 10:75719849-75719871 CTTTATAAGCTGGATATGGTAGG + Intronic
1070991674 10:80738918-80738940 CAATCTAAACTAATCATGGTTGG - Intergenic
1071891832 10:90016706-90016728 CTTTATAAGTTAATATTGGTAGG + Intergenic
1073797903 10:107007960-107007982 CTTTATAATATTATCATGGGAGG - Intronic
1075959410 10:126555375-126555397 CTGTTTAAGCTAATCAGGCTGGG + Intronic
1077560949 11:3260568-3260590 CTTTATAAGCTAGTGAAAGTGGG + Intergenic
1077566846 11:3306398-3306420 CTTTATAAGCTAGTGAAAGTGGG + Intergenic
1078557484 11:12341863-12341885 CTTTACATGCCAATCATCGTAGG + Intronic
1079164986 11:18032270-18032292 CCTAATAAACCAATCATGGTGGG + Intronic
1080998117 11:37630274-37630296 CTTCATAATTTAATCTTGGTAGG + Intergenic
1081948291 11:47018587-47018609 CTTAAAAAGCTAAACATGGCTGG - Intronic
1086305391 11:85474415-85474437 TTTTAAAAGCTCACCATGGTTGG - Intronic
1086729652 11:90232128-90232150 GTTTACAAGCCAATAATGGTGGG + Intergenic
1087246405 11:95843201-95843223 ATTTTTAAGCTCATTATGGTGGG - Intronic
1087693762 11:101352281-101352303 GTTTACAAGCTGATCATGTTGGG - Intergenic
1088089112 11:106016837-106016859 CTTGATAACCTATTTATGGTTGG - Intronic
1091362921 11:134992373-134992395 CTTTATAATCTAATGATTGGGGG + Intergenic
1093116660 12:15220638-15220660 CTTTATAAGGTAATCATGCTTGG + Intronic
1096903448 12:54909617-54909639 CTTTATAATTCAATCTTGGTAGG - Intergenic
1097487382 12:60222104-60222126 CTTTATAATATAATTATGGCAGG - Intergenic
1098233288 12:68394761-68394783 ATATATAAGCTGATGATGGTAGG + Intergenic
1098634228 12:72761333-72761355 CTTTCTAAGTCAATCTTGGTAGG - Intergenic
1104529642 12:129557068-129557090 CTTTAAAAGTGAATAATGGTGGG - Intronic
1104540101 12:129656081-129656103 CTTTCTAAGTGAATAATGGTTGG - Intronic
1106520427 13:30492692-30492714 CTTTAAAAGTTAAACATGGCCGG + Intronic
1108224417 13:48273788-48273810 GTTTAAAAGCTAATCATTATTGG - Intergenic
1108263378 13:48680024-48680046 CTTTACAAGGAAATAATGGTAGG - Intronic
1108431346 13:50357033-50357055 CTTTAAAAGTTAATCATGCATGG - Intronic
1109710660 13:66154880-66154902 CTATTTAAGTTAACCATGGTTGG - Intergenic
1109884987 13:68530316-68530338 ATTTATAATATAATTATGGTTGG - Intergenic
1110724780 13:78808356-78808378 ATTTATAATTTAATCTTGGTAGG + Intergenic
1110998359 13:82142620-82142642 TTTTATAACCCAATCATGGATGG + Intergenic
1111005717 13:82245606-82245628 CTGTGTTAGCTAATCATAGTAGG - Intergenic
1112945434 13:104921014-104921036 GTTTTTAAGCTAATCAGGGAGGG + Intergenic
1118692448 14:68352953-68352975 CTCTATAGGCTAAACATGGGAGG - Intronic
1120089050 14:80309976-80309998 CTTTGTAGGCTAATCATGAGAGG + Intronic
1120365805 14:83567122-83567144 CTTTATAAACTATCCATGATGGG - Intergenic
1124353205 15:28974994-28975016 CTGTCTAAGCTAATCATGAAGGG + Intronic
1125825301 15:42671495-42671517 CATTCTAAACTAATCCTGGTTGG + Intronic
1126228491 15:46298362-46298384 CTTTTTAAGGTAATGATTGTGGG + Intergenic
1128784721 15:70386223-70386245 ATTTATAAGCAAATTATGGCCGG - Intergenic
1132921230 16:2395221-2395243 GGTTATAAACTAATCATGGCTGG - Intergenic
1134781387 16:16899816-16899838 CTTTATAATTTAATCTTGGTAGG + Intergenic
1135008734 16:18853900-18853922 CTTTAAAAGCAAATGATGGAGGG + Intronic
1141221095 16:82069938-82069960 CTTTATAAACTAATGATGCCTGG - Intronic
1142142182 16:88477464-88477486 CTTTAAAAGCCAAACATGGCTGG + Intronic
1144425280 17:15135512-15135534 TTTTATAACCTAAGTATGGTAGG + Intergenic
1151881510 17:76898159-76898181 CTATGTAACCTAATCTTGGTAGG - Intronic
1153526819 18:6004308-6004330 CTTTATGAGTAAGTCATGGTGGG - Intronic
1154488912 18:14903969-14903991 CTTTATAATCTAATGATTGGGGG - Intergenic
1155943467 18:31822754-31822776 CTGTATCTGCTAATCTTGGTTGG + Intergenic
1156770818 18:40721867-40721889 CTTTATAATTGAATCTTGGTAGG - Intergenic
1161753877 19:6117277-6117299 CTTTATGAGCTAATGCTGCTAGG - Intronic
1161958784 19:7511237-7511259 CTTTAAAAATTAATCTTGGTGGG - Intronic
926542106 2:14193773-14193795 CTTTATATTCTGACCATGGTTGG + Intergenic
929700398 2:44157610-44157632 CTTTTTATGCTAAACATGGTAGG - Intergenic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
932154768 2:69406333-69406355 CTTGATATGCTAATGATGTTAGG + Intronic
935378864 2:102429280-102429302 CTTTATGATCCAATCTTGGTAGG + Intronic
936017326 2:108969530-108969552 CTTTATATGCTATTCAGGGAGGG + Intronic
938919092 2:135976499-135976521 TGATATGAGCTAATCATGGTGGG - Intronic
940489754 2:154343830-154343852 CTTTATGAGCTATTCAAGCTTGG + Intronic
940916483 2:159262054-159262076 CTTTGTAAGCTTAGCATGGCTGG - Intronic
942726154 2:179009836-179009858 CTTATTAAGCTAATCAGGGAGGG + Intronic
944029590 2:195218517-195218539 TTTAATAATCTAATCATGTTGGG + Intergenic
945126989 2:206523320-206523342 CTCTATAACCTATTCATGCTAGG + Intronic
945754172 2:213825965-213825987 CTTTATGGGTTAATCTTGGTAGG + Intronic
945815832 2:214604070-214604092 CTTTAAAAGCTACTGATGCTGGG - Intergenic
946573926 2:221053545-221053567 CTTAATAAGCTAGCCATGCTGGG + Intergenic
947305947 2:228747518-228747540 TTTTATAAGCTAAGTCTGGTGGG + Intergenic
1170405770 20:16034448-16034470 CTTTTTAAGCTAATGATTGTTGG - Intronic
1175548253 20:59794747-59794769 CTTCATAAGTAAATCTTGGTAGG + Intronic
1177126109 21:17194582-17194604 CTGTATAAGCTAATCATATCTGG - Intergenic
1177174319 21:17688485-17688507 GTTAATAAGCTAATCAGGGAGGG - Intergenic
1177852177 21:26361647-26361669 CTGGAAAAGCTACTCATGGTGGG - Intergenic
1185145029 22:49128609-49128631 CTTTATAAAATAACAATGGTCGG - Intergenic
952480058 3:33752024-33752046 CTTTAAAAATTATTCATGGTGGG - Intergenic
953058151 3:39404830-39404852 CTTTAAAAGCTACTGATGCTTGG + Intergenic
957890483 3:86351187-86351209 CTTCATAATGTAATCTTGGTAGG + Intergenic
959156803 3:102676602-102676624 CTTTATAGGCAAAGCATGATGGG + Intergenic
959491427 3:106993508-106993530 TTTTATAATTTAATCTTGGTAGG - Intergenic
961799381 3:129433475-129433497 ATTTAAAAGCTAATCATGCAAGG - Intronic
963269670 3:143273347-143273369 CTTTGGGAGCTAATCAGGGTGGG + Intronic
964018145 3:151973301-151973323 TTTCATAAACTAATCATAGTGGG + Intergenic
964110805 3:153085388-153085410 CTTTAACAGCTAACCATGGCCGG + Intergenic
966550341 3:181198252-181198274 CTTTATAAGATTATCATTTTGGG - Intergenic
968761473 4:2444514-2444536 CTTGATAGGCTGATGATGGTGGG + Intronic
970673402 4:18420965-18420987 CTTTATTACTTAATCATGGTGGG - Intergenic
971014830 4:22477569-22477591 TTTTATAAGCTACTCATGTTTGG - Intronic
974304277 4:60111682-60111704 CTTTATAACCCAATAATGCTGGG - Intergenic
975159663 4:71110968-71110990 TTTTATACTCTAATCATGGTTGG + Intergenic
975958742 4:79874926-79874948 TTTGATAATCTAATCATGGGAGG - Intergenic
977764117 4:100777226-100777248 CTTTATAAACTACTCAGGATTGG - Intronic
980195772 4:129587280-129587302 CTTTATGATTTAGTCATGGTAGG - Intergenic
980260884 4:130445767-130445789 CTTTATAATTTAATCTTGGCAGG + Intergenic
981642765 4:146964163-146964185 CTTTCTAATCTAATCATTTTGGG + Intergenic
983467187 4:168108928-168108950 CTTTATAACCTCATCTAGGTTGG + Intronic
983517078 4:168669258-168669280 CTTTTAAAGCTAATTATTGTGGG - Intronic
983748967 4:171239758-171239780 CTTCATAAGCCAATCACAGTGGG - Intergenic
985095393 4:186407872-186407894 CTTTCTCAGCTACTCATGGCTGG + Intergenic
985179729 4:187245366-187245388 CTTCATCAGTTAATCTTGGTAGG + Intergenic
986074562 5:4321936-4321958 ATTTATAATTTAATCTTGGTAGG - Intergenic
987102829 5:14607288-14607310 GTTCATATGCTAATCATAGTTGG + Intronic
987860230 5:23476738-23476760 TTTTGTAAGTTAATCATGTTGGG - Intergenic
989631625 5:43489222-43489244 ATTAATAAGCTAATAATGGAGGG + Intronic
990787217 5:59435194-59435216 CATTTTAAGATAATCTTGGTAGG - Intronic
991152268 5:63384304-63384326 CTTTTTAAAATAATGATGGTGGG - Intergenic
994509115 5:100681084-100681106 CTTTATAATTTAATCATAGAAGG + Intergenic
994731941 5:103502276-103502298 CTTTATGTATTAATCATGGTGGG + Intergenic
995681467 5:114725618-114725640 ATTTAAAGGCAAATCATGGTAGG - Intergenic
995829489 5:116338425-116338447 CTTCATAATTTAATCTTGGTAGG - Intronic
997493348 5:134298228-134298250 TTTTAAAAGCTATTCATGGCTGG - Intronic
1000214223 5:159139467-159139489 GTTTTGAAGCAAATCATGGTAGG + Intergenic
1000722733 5:164728668-164728690 ATTCATAAGCTAATCATGTGGGG - Intergenic
1003359912 6:5415111-5415133 CTTTAAAAGTTAGTCATGGCCGG - Intronic
1003680952 6:8256137-8256159 CTATACAAGCTAATCATAGATGG + Intergenic
1003903921 6:10681166-10681188 CTTCATAATTTAATCTTGGTAGG + Intronic
1005404611 6:25473248-25473270 ATTAGTAACCTAATCATGGTAGG + Intronic
1007233598 6:40371856-40371878 CTTTATGATTTAATCATGGTAGG + Intergenic
1008409991 6:51165930-51165952 CTTCATAATTTAATCTTGGTAGG + Intergenic
1008786995 6:55180479-55180501 TTTGATAAGCCAATCAAGGTCGG + Intronic
1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG + Intronic
1009384025 6:63067940-63067962 CTTATTAAGCTAATCAGGGAGGG - Intergenic
1010899824 6:81412825-81412847 TTAGATAAGGTAATCATGGTGGG - Intergenic
1011347848 6:86390904-86390926 CTTTATAAGTTAATCAGTCTTGG + Intergenic
1011618455 6:89219994-89220016 CAATGTAAGCTAAGCATGGTTGG + Intronic
1011906197 6:92371523-92371545 ATTTATAAGAAAATCATGGGTGG + Intergenic
1013279618 6:108623238-108623260 ACTTATAAGCTAATCAGAGTAGG - Intronic
1013568569 6:111395860-111395882 CTTGATAAGTTAATCATAGAAGG - Intronic
1014559906 6:122876986-122877008 CTTTATAATCTACTCATGCTTGG + Intergenic
1014737283 6:125108649-125108671 CTTCATAATTTAATCTTGGTAGG + Intergenic
1015581833 6:134733803-134733825 GTTTAGAAGCTAATCATTATTGG - Intergenic
1015641761 6:135341638-135341660 CTTTTTCAGTTTATCATGGTTGG - Intronic
1022234338 7:28446489-28446511 CTTTATAAAATAATAATTGTAGG + Intronic
1023754095 7:43399698-43399720 CTTTATAAGGTGATCAGGGTTGG + Intronic
1025855503 7:65273438-65273460 TTTTATAATTTAATCTTGGTGGG + Intergenic
1029024357 7:97400259-97400281 TCTTATAATATAATCATGGTTGG - Intergenic
1029240862 7:99161155-99161177 CTTTATAACCTAATCTTAGAAGG - Intergenic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1032052883 7:128659998-128660020 TTTTATAACCTAATCTTGGAAGG + Intergenic
1034893408 7:154859675-154859697 CTTAAGAAGGTAATTATGGTTGG + Intronic
1035685139 8:1518561-1518583 ATTTATTAGCTGATCAAGGTTGG - Intronic
1037971025 8:23172096-23172118 CTTTATAAGTTACTCAGGCTCGG - Intergenic
1039398312 8:37246606-37246628 ATTTATCAGCTAATAATGGCTGG + Intergenic
1040467283 8:47706732-47706754 CTTTATATGGTAATCCTAGTAGG - Intronic
1041501281 8:58541520-58541542 GTTTAAAAGCTACTCAGGGTAGG + Intergenic
1042286260 8:67114659-67114681 CCTGATAAGATAACCATGGTAGG + Intronic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1046274131 8:111934767-111934789 CATTATATGCAGATCATGGTTGG - Intergenic
1050468264 9:5956108-5956130 TTTTTTAAGCTAATCAGAGTAGG - Intronic
1050633914 9:7589767-7589789 TTTTAAAAGCTACTCATGCTTGG + Intergenic
1051376018 9:16403831-16403853 TTTTATAACCCAATCATGGAAGG + Intergenic
1053178597 9:35947957-35947979 CTTTATAAGGAGATCAAGGTGGG - Intergenic
1054982946 9:71227767-71227789 CTTTATAATTAAATCTTGGTAGG - Intronic
1055528945 9:77164101-77164123 TTCTCTAAGCTAATCATCGTTGG + Intergenic
1056478352 9:86975136-86975158 CTTTCCAAGCTAAACATGGAGGG - Intergenic
1059538897 9:115111333-115111355 CTGTGTAACCTAATCATGGAAGG - Intronic
1061854748 9:133435825-133435847 CTTTAAAAGCCAAACATGCTGGG - Intronic
1062181026 9:135191413-135191435 TTTTATAACCTAATCAAGGGAGG + Intergenic
1189973657 X:46441843-46441865 CTTTCTAAGCTAGTCATCCTGGG + Intergenic
1190729339 X:53214919-53214941 CTGTATAGGCTAGTCATGCTAGG + Intronic
1193288936 X:79748765-79748787 CTTCATAATTTAATCCTGGTAGG + Intergenic
1193345563 X:80399754-80399776 GTTTAAAAGCTAATCATTATTGG - Intronic
1193654422 X:84182621-84182643 CTTGATGAACTAATCAAGGTAGG + Intronic
1195170571 X:102263691-102263713 TTTTAAAATCTAATCATGTTTGG + Intergenic
1195188288 X:102423408-102423430 TTTTAAAATCTAATCATGTTTGG - Intronic
1195455210 X:105060757-105060779 CTTTATGATTTAATCTTGGTAGG + Intronic
1196543961 X:116941056-116941078 CTTTTTAAACTAATTATGTTGGG + Intergenic
1197015212 X:121616797-121616819 CTTTATAATTTAATCTTCGTAGG + Intergenic
1198452991 X:136786510-136786532 CTTTATAAGTTACTCAGTGTTGG - Intergenic
1199366418 X:146990063-146990085 CTTCATGATTTAATCATGGTAGG - Intergenic
1199799887 X:151240088-151240110 CTTTATAAACTAATAATGATGGG + Intergenic
1200754190 Y:6974366-6974388 CTTAATAAGCTAATGAAGGCCGG - Intronic
1201643822 Y:16205611-16205633 CTCTCTAAACTAATCCTGGTTGG - Intergenic
1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG + Intergenic
1202092307 Y:21206489-21206511 ATTTATAAGTTAATCTTGGTAGG - Intergenic