ID: 1043025419

View in Genome Browser
Species Human (GRCh38)
Location 8:75061411-75061433
Sequence GATGGATTAAAAGGTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043025419_1043025426 6 Left 1043025419 8:75061411-75061433 CCAGAAATACCTTTTAATCCATC No data
Right 1043025426 8:75061440-75061462 ATTAATGGGTATATACCCAAAGG 0: 94
1: 19455
2: 11887
3: 7282
4: 5975
1043025419_1043025421 -9 Left 1043025419 8:75061411-75061433 CCAGAAATACCTTTTAATCCATC No data
Right 1043025421 8:75061425-75061447 TAATCCATCAATCCCATTAATGG No data
1043025419_1043025422 -8 Left 1043025419 8:75061411-75061433 CCAGAAATACCTTTTAATCCATC No data
Right 1043025422 8:75061426-75061448 AATCCATCAATCCCATTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043025419 Original CRISPR GATGGATTAAAAGGTATTTC TGG (reversed) Intergenic
No off target data available for this crispr