ID: 1043028479

View in Genome Browser
Species Human (GRCh38)
Location 8:75102152-75102174
Sequence AATTATATTTAGAAGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043028479_1043028484 25 Left 1043028479 8:75102152-75102174 CCTTCCAACTTCTAAATATAATT No data
Right 1043028484 8:75102200-75102222 TTGAGTACCACATTATGCGGTGG No data
1043028479_1043028482 22 Left 1043028479 8:75102152-75102174 CCTTCCAACTTCTAAATATAATT No data
Right 1043028482 8:75102197-75102219 TCCTTGAGTACCACATTATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043028479 Original CRISPR AATTATATTTAGAAGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr