ID: 1043029883

View in Genome Browser
Species Human (GRCh38)
Location 8:75120962-75120984
Sequence CTTTTATCCTTAAGGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043029881_1043029883 -7 Left 1043029881 8:75120946-75120968 CCTCAAGGATGTTATTCTTTTAT No data
Right 1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG No data
1043029879_1043029883 9 Left 1043029879 8:75120930-75120952 CCATCTCACTAGAACTCCTCAAG No data
Right 1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043029883 Original CRISPR CTTTTATCCTTAAGGATAAA AGG Intergenic
No off target data available for this crispr