ID: 1043033116

View in Genome Browser
Species Human (GRCh38)
Location 8:75164170-75164192
Sequence CTGAGCTATCACCTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043033116_1043033121 14 Left 1043033116 8:75164170-75164192 CCATCTCAAAGGTGATAGCTCAG No data
Right 1043033121 8:75164207-75164229 TGGCTAGAAATTCATGCCCAGGG No data
1043033116_1043033120 13 Left 1043033116 8:75164170-75164192 CCATCTCAAAGGTGATAGCTCAG No data
Right 1043033120 8:75164206-75164228 CTGGCTAGAAATTCATGCCCAGG No data
1043033116_1043033118 -10 Left 1043033116 8:75164170-75164192 CCATCTCAAAGGTGATAGCTCAG No data
Right 1043033118 8:75164183-75164205 GATAGCTCAGTAGTGTGGAAAGG No data
1043033116_1043033119 -6 Left 1043033116 8:75164170-75164192 CCATCTCAAAGGTGATAGCTCAG No data
Right 1043033119 8:75164187-75164209 GCTCAGTAGTGTGGAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043033116 Original CRISPR CTGAGCTATCACCTTTGAGA TGG (reversed) Intergenic
No off target data available for this crispr