ID: 1043033125 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:75164249-75164271 |
Sequence | GTTCGGCAGCACCATGCTGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043033125_1043033127 | 5 | Left | 1043033125 | 8:75164249-75164271 | CCTTCAGCATGGTGCTGCCGAAC | No data | ||
Right | 1043033127 | 8:75164277-75164299 | CTCTGATTTGACATCTCGTCTGG | 0: 1 1: 0 2: 0 3: 40 4: 120 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043033125 | Original CRISPR | GTTCGGCAGCACCATGCTGA AGG (reversed) | Intergenic | ||