ID: 1043033125

View in Genome Browser
Species Human (GRCh38)
Location 8:75164249-75164271
Sequence GTTCGGCAGCACCATGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043033125_1043033127 5 Left 1043033125 8:75164249-75164271 CCTTCAGCATGGTGCTGCCGAAC No data
Right 1043033127 8:75164277-75164299 CTCTGATTTGACATCTCGTCTGG 0: 1
1: 0
2: 0
3: 40
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043033125 Original CRISPR GTTCGGCAGCACCATGCTGA AGG (reversed) Intergenic