ID: 1043033849

View in Genome Browser
Species Human (GRCh38)
Location 8:75172028-75172050
Sequence GGCTATAATCCCAATGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043033847_1043033849 -5 Left 1043033847 8:75172010-75172032 CCAGGTATGGTGGCTCATGGCTA No data
Right 1043033849 8:75172028-75172050 GGCTATAATCCCAATGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043033849 Original CRISPR GGCTATAATCCCAATGCTGT GGG Intergenic
No off target data available for this crispr