ID: 1043043422

View in Genome Browser
Species Human (GRCh38)
Location 8:75291032-75291054
Sequence GAAAATACAAAGAGGCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043043422_1043043424 -3 Left 1043043422 8:75291032-75291054 CCAAGATGCCTCTTTGTATTTTC No data
Right 1043043424 8:75291052-75291074 TTCATTGAAAATAAAAATGTAGG No data
1043043422_1043043426 30 Left 1043043422 8:75291032-75291054 CCAAGATGCCTCTTTGTATTTTC No data
Right 1043043426 8:75291085-75291107 GAATCCATGTCCAGTTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043043422 Original CRISPR GAAAATACAAAGAGGCATCT TGG (reversed) Intergenic
No off target data available for this crispr