ID: 1043045613

View in Genome Browser
Species Human (GRCh38)
Location 8:75319928-75319950
Sequence CTGCAGTCATTGAGCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043045609_1043045613 16 Left 1043045609 8:75319889-75319911 CCACCTCATTCATTAGCCATATG No data
Right 1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG No data
1043045608_1043045613 17 Left 1043045608 8:75319888-75319910 CCCACCTCATTCATTAGCCATAT No data
Right 1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG No data
1043045611_1043045613 0 Left 1043045611 8:75319905-75319927 CCATATGTTCTTACAATATCATC No data
Right 1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG No data
1043045610_1043045613 13 Left 1043045610 8:75319892-75319914 CCTCATTCATTAGCCATATGTTC No data
Right 1043045613 8:75319928-75319950 CTGCAGTCATTGAGCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043045613 Original CRISPR CTGCAGTCATTGAGCAACAC AGG Intergenic
No off target data available for this crispr