ID: 1043048089

View in Genome Browser
Species Human (GRCh38)
Location 8:75352579-75352601
Sequence TTACCACAGCTGATGCTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043048080_1043048089 4 Left 1043048080 8:75352552-75352574 CCTGCCCACCACCTGTTCCTCCC 0: 11
1: 30
2: 84
3: 248
4: 921
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data
1043048081_1043048089 0 Left 1043048081 8:75352556-75352578 CCCACCACCTGTTCCTCCCCGTA No data
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data
1043048079_1043048089 5 Left 1043048079 8:75352551-75352573 CCCTGCCCACCACCTGTTCCTCC No data
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data
1043048082_1043048089 -1 Left 1043048082 8:75352557-75352579 CCACCACCTGTTCCTCCCCGTAT No data
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data
1043048084_1043048089 -7 Left 1043048084 8:75352563-75352585 CCTGTTCCTCCCCGTATTACCAC No data
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data
1043048083_1043048089 -4 Left 1043048083 8:75352560-75352582 CCACCTGTTCCTCCCCGTATTAC No data
Right 1043048089 8:75352579-75352601 TTACCACAGCTGATGCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043048089 Original CRISPR TTACCACAGCTGATGCTCTC TGG Intergenic
No off target data available for this crispr