ID: 1043050992

View in Genome Browser
Species Human (GRCh38)
Location 8:75385339-75385361
Sequence AAACCCTGCTTCACAAGGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043050992_1043050994 10 Left 1043050992 8:75385339-75385361 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1043050994 8:75385372-75385394 CAGCAACCAAAATGAGATTATGG No data
1043050992_1043050996 20 Left 1043050992 8:75385339-75385361 CCTATCCTTGTGAAGCAGGGTTT No data
Right 1043050996 8:75385382-75385404 AATGAGATTATGGAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043050992 Original CRISPR AAACCCTGCTTCACAAGGAT AGG (reversed) Intergenic