ID: 1043050992 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:75385339-75385361 |
| Sequence | AAACCCTGCTTCACAAGGAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1043050992_1043050994 | 10 | Left | 1043050992 | 8:75385339-75385361 | CCTATCCTTGTGAAGCAGGGTTT | No data | ||
| Right | 1043050994 | 8:75385372-75385394 | CAGCAACCAAAATGAGATTATGG | No data | ||||
| 1043050992_1043050996 | 20 | Left | 1043050992 | 8:75385339-75385361 | CCTATCCTTGTGAAGCAGGGTTT | No data | ||
| Right | 1043050996 | 8:75385382-75385404 | AATGAGATTATGGAGTAGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1043050992 | Original CRISPR | AAACCCTGCTTCACAAGGAT AGG (reversed) | Intergenic | ||