ID: 1043052129

View in Genome Browser
Species Human (GRCh38)
Location 8:75397188-75397210
Sequence CTCCAAATACAGTCATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043052125_1043052129 5 Left 1043052125 8:75397160-75397182 CCCTTAATTATTTCCTTAGAGGC No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052127_1043052129 -8 Left 1043052127 8:75397173-75397195 CCTTAGAGGCCACATCTCCAAAT No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052122_1043052129 22 Left 1043052122 8:75397143-75397165 CCTTATGACCTCATTTACCCTTA No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052126_1043052129 4 Left 1043052126 8:75397161-75397183 CCTTAATTATTTCCTTAGAGGCC No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052123_1043052129 14 Left 1043052123 8:75397151-75397173 CCTCATTTACCCTTAATTATTTC No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052119_1043052129 27 Left 1043052119 8:75397138-75397160 CCCACCCTTATGACCTCATTTAC No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052121_1043052129 23 Left 1043052121 8:75397142-75397164 CCCTTATGACCTCATTTACCCTT No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data
1043052120_1043052129 26 Left 1043052120 8:75397139-75397161 CCACCCTTATGACCTCATTTACC No data
Right 1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043052129 Original CRISPR CTCCAAATACAGTCATGCTA AGG Intergenic
No off target data available for this crispr