ID: 1043052323

View in Genome Browser
Species Human (GRCh38)
Location 8:75399151-75399173
Sequence ATACTGTAATTGATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043052322_1043052323 16 Left 1043052322 8:75399112-75399134 CCATTGCAGAGGGAGAGTGTGAA No data
Right 1043052323 8:75399151-75399173 ATACTGTAATTGATAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043052323 Original CRISPR ATACTGTAATTGATAGAACA AGG Intergenic
No off target data available for this crispr