ID: 1043052402

View in Genome Browser
Species Human (GRCh38)
Location 8:75400350-75400372
Sequence CTGGTAAGTCAGAGCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043052402_1043052405 25 Left 1043052402 8:75400350-75400372 CCATATCAGCTCTGACTTACCAG No data
Right 1043052405 8:75400398-75400420 TTCCGCGATCACCAGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043052402 Original CRISPR CTGGTAAGTCAGAGCTGATA TGG (reversed) Intergenic
No off target data available for this crispr